Incidental Mutation 'RF005:Triobp'
ID602783
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF005 (G1)
Quality Score217.468
Status Not validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationsmall insertion (10 aa in frame mutation)
DNA Base Change (assembly) GACAA to GACAACCCCAGGACTCCCTGTGCCCAACGGAACAA at 78967061 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228]
Predicted Effect probably benign
Transcript: ENSMUST00000109689
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109690
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140228
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
A030005L19Rik CTGCTG CTGCTGTGGATGCTG 1: 82,913,585 probably benign Het
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Adamtsl3 A G 7: 82,612,395 T40A Het
Adgra3 A T 5: 50,013,387 probably null Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Baiap2 G A 11: 119,996,529 E217K possibly damaging Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cfb C T 17: 34,858,046 V538I possibly damaging Het
Col6a3 A G 1: 90,811,262 S1022P probably benign Het
Cpeb1 A G 7: 81,361,806 L129S possibly damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyp4f16 C A 17: 32,545,195 probably null Het
Dlg5 G A 14: 24,158,493 Q882* probably null Het
Fsip2 T A 2: 82,992,532 I6203K probably benign Het
Gabre CCGGCT CCGGCTACGGCT X: 72,270,045 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gm9513 T C 9: 36,475,674 S13P possibly damaging Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hmcn1 T A 1: 150,635,146 K3609* probably null Het
Hsdl2 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG 4: 59,610,652 probably benign Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mms22l A G 4: 24,517,207 I363V probably benign Het
Myo7a T C 7: 98,093,617 I391V probably benign Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Olfr1039 T C 2: 86,131,070 M198V probably benign Het
Olfr592 T C 7: 103,186,691 I30T possibly damaging Het
Olfr635 A G 7: 103,979,561 D123G probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Prex2 A C 1: 11,185,166 D1145A possibly damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prp2 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC 6: 132,600,501 probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef1 C A 2: 29,707,195 probably null Het
Rgl1 G A 1: 152,521,363 S684L probably benign Het
Sbf2 T A 7: 110,317,008 D1552V probably damaging Het
Serpinh1 C T 7: 99,346,203 V391M probably damaging Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Tbl3 TCTT TCTTCTT 17: 24,702,541 probably benign Het
Tex15 T A 8: 33,576,677 M2045K probably benign Het
Tmprss15 T C 16: 78,953,801 *1070W probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 GAA GAACAA 14: 53,649,754 probably benign Het
Trim33 GCCCCGGCCCCCG GCCCCG 3: 103,280,212 probably null Het
Tub C A 7: 109,022,639 Q95K probably benign Het
Uhrf1bp1 A T 17: 27,885,531 D517V probably damaging Het
Usp9y T A Y: 1,435,046 Q261L probably benign Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vill G A 9: 119,060,439 V148M probably damaging Het
Vmn2r120 C T 17: 57,521,991 E535K possibly damaging Het
Zfp451 A T 1: 33,776,792 Y692* probably null Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
R7688:Triobp UTSW 15 78961111 splice site probably null
R7805:Triobp UTSW 15 78974004 missense probably benign 0.37
R7972:Triobp UTSW 15 78967986 missense probably damaging 1.00
R7977:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7987:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7999:Triobp UTSW 15 78959944 missense probably damaging 0.99
R8344:Triobp UTSW 15 78958275 missense possibly damaging 0.67
R8348:Triobp UTSW 15 78994126 missense possibly damaging 0.85
RF001:Triobp UTSW 15 78967027 small insertion probably benign
RF007:Triobp UTSW 15 78967044 small insertion probably benign
RF022:Triobp UTSW 15 78974282 missense probably benign 0.05
RF028:Triobp UTSW 15 78967039 small insertion probably benign
RF032:Triobp UTSW 15 78967036 small insertion probably benign
RF035:Triobp UTSW 15 78967039 small insertion probably benign
RF039:Triobp UTSW 15 78967036 small insertion probably benign
RF039:Triobp UTSW 15 78967039 small insertion probably benign
RF040:Triobp UTSW 15 78967063 small insertion probably benign
RF049:Triobp UTSW 15 78967061 small insertion probably benign
RF051:Triobp UTSW 15 78967034 small insertion probably benign
RF058:Triobp UTSW 15 78967044 small insertion probably benign
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Z1177:Triobp UTSW 15 79002181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCTAGGACTCCCTGTAC -3'
(R):5'- AGATGCTCCCATTTGCTGC -3'

Sequencing Primer
(F):5'- TAGGACTCCCTGTACCCAGAG -3'
(R):5'- TCCCATTTGCTGCAGGAAG -3'
Posted On2019-12-04