Incidental Mutation 'RF005:Vmn2r120'
Institutional Source Beutler Lab
Gene Symbol Vmn2r120
Ensembl Gene ENSMUSG00000090655
Gene Namevomeronasal 2, receptor 120
Accession Numbers

Genbank: NM_001104591; MGI: 3644483

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #RF005 (G1)
Quality Score225.009
Status Validated
Chromosomal Location57508783-57545314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57521991 bp
Amino Acid Change Glutamic Acid to Lysine at position 535 (E535K)
Ref Sequence ENSEMBL: ENSMUSP00000129296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165781]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165781
AA Change: E535K

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129296
Gene: ENSMUSG00000090655
AA Change: E535K

signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 80 474 5.9e-42 PFAM
Pfam:NCD3G 517 570 7.5e-22 PFAM
Pfam:7tm_3 598 836 1.3e-54 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 94% (65/69)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik CTGCTG CTGCTGTGGATGCTG 1: 82,913,585 probably benign Het
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Adamtsl3 A G 7: 82,612,395 T40A Het
Adgra3 A T 5: 50,013,387 probably null Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Baiap2 G A 11: 119,996,529 E217K possibly damaging Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cfb C T 17: 34,858,046 V538I possibly damaging Het
Col6a3 A G 1: 90,811,262 S1022P probably benign Het
Cpeb1 A G 7: 81,361,806 L129S possibly damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyp4f16 C A 17: 32,545,195 probably null Het
Dlg5 G A 14: 24,158,493 Q882* probably null Het
Fsip2 T A 2: 82,992,532 I6203K probably benign Het
Gabre CCGGCT CCGGCTACGGCT X: 72,270,045 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gm9513 T C 9: 36,475,674 S13P possibly damaging Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hmcn1 T A 1: 150,635,146 K3609* probably null Het
Hsdl2 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG 4: 59,610,652 probably benign Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mms22l A G 4: 24,517,207 I363V probably benign Het
Myo7a T C 7: 98,093,617 I391V probably benign Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Olfr1039 T C 2: 86,131,070 M198V probably benign Het
Olfr592 T C 7: 103,186,691 I30T possibly damaging Het
Olfr635 A G 7: 103,979,561 D123G probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Prex2 A C 1: 11,185,166 D1145A possibly damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef1 C A 2: 29,707,195 probably null Het
Rgl1 G A 1: 152,521,363 S684L probably benign Het
Sbf2 T A 7: 110,317,008 D1552V probably damaging Het
Serpinh1 C T 7: 99,346,203 V391M probably damaging Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Tbl3 TCTT TCTTCTT 17: 24,702,541 probably benign Het
Tex15 T A 8: 33,576,677 M2045K probably benign Het
Tmprss15 T C 16: 78,953,801 *1070W probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 GAA GAACAA 14: 53,649,754 probably benign Het
Trim33 GCCCCGGCCCCCG GCCCCG 3: 103,280,212 probably null Het
Tub C A 7: 109,022,639 Q95K probably benign Het
Uhrf1bp1 A T 17: 27,885,531 D517V probably damaging Het
Usp9y T A Y: 1,435,046 Q261L probably benign Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vill G A 9: 119,060,439 V148M probably damaging Het
Zfp451 A T 1: 33,776,792 Y692* probably null Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Other mutations in Vmn2r120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Vmn2r120 APN 17 57525732 missense possibly damaging 0.86
IGL01346:Vmn2r120 APN 17 57545232 missense probably benign 0.11
IGL01996:Vmn2r120 APN 17 57525222 missense possibly damaging 0.92
IGL02503:Vmn2r120 APN 17 57509385 missense probably benign 0.40
IGL02582:Vmn2r120 APN 17 57524724 missense probably damaging 0.99
IGL02747:Vmn2r120 APN 17 57524719 missense probably benign 0.19
IGL02896:Vmn2r120 APN 17 57509008 missense probably damaging 1.00
IGL03139:Vmn2r120 APN 17 57524742 missense probably benign 0.39
IGL03342:Vmn2r120 APN 17 57509372 missense probably benign 0.03
A4554:Vmn2r120 UTSW 17 57525715 missense probably benign 0.01
R0207:Vmn2r120 UTSW 17 57525052 missense probably benign 0.17
R0472:Vmn2r120 UTSW 17 57524518 missense probably benign 0.03
R0517:Vmn2r120 UTSW 17 57508949 missense probably damaging 1.00
R1109:Vmn2r120 UTSW 17 57525829 missense probably benign 0.09
R1316:Vmn2r120 UTSW 17 57525939 missense probably benign 0.28
R1543:Vmn2r120 UTSW 17 57522374 missense probably benign 0.09
R1795:Vmn2r120 UTSW 17 57525038 missense probably benign 0.35
R1850:Vmn2r120 UTSW 17 57525826 missense probably benign 0.19
R1920:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1921:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1922:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R2063:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2064:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2065:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2067:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2286:Vmn2r120 UTSW 17 57508958 missense probably damaging 1.00
R2291:Vmn2r120 UTSW 17 57509479 missense probably damaging 1.00
R3416:Vmn2r120 UTSW 17 57509241 missense possibly damaging 0.89
R3874:Vmn2r120 UTSW 17 57524954 missense probably benign 0.40
R4023:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4024:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4348:Vmn2r120 UTSW 17 57522466 missense possibly damaging 0.47
R4409:Vmn2r120 UTSW 17 57509477 missense probably damaging 1.00
R4610:Vmn2r120 UTSW 17 57509120 missense probably damaging 1.00
R4771:Vmn2r120 UTSW 17 57524887 missense probably damaging 1.00
R4786:Vmn2r120 UTSW 17 57522048 missense probably benign 0.14
R4927:Vmn2r120 UTSW 17 57509125 missense probably damaging 1.00
R5285:Vmn2r120 UTSW 17 57536703 missense probably damaging 1.00
R5566:Vmn2r120 UTSW 17 57545290 missense possibly damaging 0.95
R5578:Vmn2r120 UTSW 17 57522514 missense probably benign 0.01
R5643:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5644:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5781:Vmn2r120 UTSW 17 57524938 missense probably benign 0.00
R6084:Vmn2r120 UTSW 17 57525721 missense probably benign 0.15
R6120:Vmn2r120 UTSW 17 57525973 missense probably benign 0.02
R6160:Vmn2r120 UTSW 17 57509418 missense probably benign 0.03
R6248:Vmn2r120 UTSW 17 57545287 missense probably benign 0.03
R6256:Vmn2r120 UTSW 17 57524700 nonsense probably null
R6730:Vmn2r120 UTSW 17 57525012 missense probably benign 0.03
R6821:Vmn2r120 UTSW 17 57536659 missense probably benign 0.00
R6868:Vmn2r120 UTSW 17 57545218 missense probably benign 0.00
R6880:Vmn2r120 UTSW 17 57509187 missense probably damaging 1.00
R6986:Vmn2r120 UTSW 17 57509340 missense probably damaging 1.00
R7276:Vmn2r120 UTSW 17 57524881 missense probably benign 0.11
R7373:Vmn2r120 UTSW 17 57509406 missense probably benign 0.35
R7653:Vmn2r120 UTSW 17 57509258 missense possibly damaging 0.93
R7667:Vmn2r120 UTSW 17 57536657 missense probably benign 0.04
R7775:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7778:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7797:Vmn2r120 UTSW 17 57508874 missense probably damaging 1.00
R7824:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7902:Vmn2r120 UTSW 17 57509244 missense possibly damaging 0.87
R7922:Vmn2r120 UTSW 17 57524683 missense probably damaging 0.99
R8508:Vmn2r120 UTSW 17 57525843 missense probably benign 0.03
R8847:Vmn2r120 UTSW 17 57509217 missense probably benign 0.01
R8882:Vmn2r120 UTSW 17 57545229 missense probably benign 0.01
Z1177:Vmn2r120 UTSW 17 57509245 missense probably benign 0.00
Z1188:Vmn2r120 UTSW 17 57522436 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04