Incidental Mutation 'RF006:Esf1'
ID602806
Institutional Source Beutler Lab
Gene Symbol Esf1
Ensembl Gene ENSMUSG00000045624
Gene NameESF1 nucleolar pre-rRNA processing protein homolog
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #RF006 (G1)
Quality Score105.467
Status Not validated
Chromosome2
Chromosomal Location140119883-140170564 bp(-) (GRCm38)
Type of Mutationsmall deletion (2 aa in frame mutation)
DNA Base Change (assembly) CTCCTCTTC to CTC at 140164374 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046030]
Predicted Effect probably benign
Transcript: ENSMUST00000046030
SMART Domains Protein: ENSMUSP00000036523
Gene: ENSMUSG00000045624

DomainStartEndE-ValueType
coiled coil region 91 114 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 230 258 N/A INTRINSIC
coiled coil region 261 293 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
coiled coil region 628 652 N/A INTRINSIC
low complexity region 667 692 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
Pfam:NUC153 753 781 4.1e-15 PFAM
low complexity region 784 798 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,352,649 I146F possibly damaging Het
4930548H24Rik C T 5: 31,487,550 Q216* probably null Het
Acbd7 GTT GT 2: 3,340,699 probably null Het
Acp7 A T 7: 28,614,779 N330K possibly damaging Het
Adam25 A T 8: 40,755,797 H700L probably benign Het
Alg9 GGGTGG GGGTGGTGG 9: 50,775,417 probably benign Het
Atp8b3 A T 10: 80,526,236 V689E probably benign Het
Atxn2l A G 7: 126,495,891 V533A probably benign Het
C87414 A T 5: 93,636,703 C301S probably benign Het
Catsperb G A 12: 101,575,979 probably null Het
Ccdc13 T C 9: 121,814,207 K376R probably damaging Het
Ccdc170 C CCAA 10: 4,561,030 probably benign Het
Cdh9 G C 15: 16,855,830 R652P probably damaging Het
Cenpf A C 1: 189,657,386 C1416W probably damaging Het
Chga GCA GCATCA 12: 102,561,412 probably benign Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA 9: 87,040,441 probably benign Het
Dennd3 T C 15: 73,547,592 I744T probably damaging Het
Dnah1 C T 14: 31,307,875 R491Q probably benign Het
Eif4a2 A T 16: 23,110,278 M188L possibly damaging Het
Fat3 T C 9: 15,998,617 I2030V probably benign Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gins4 A T 8: 23,227,167 V195E possibly damaging Het
Gm17402 TCCTCCTCC TCCTCCTCCCCCTCCTCC 3: 67,365,559 probably benign Het
Gm17604 CTCTCTTTC CTC X: 165,003,818 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,764 probably benign Het
Gnpnat1 T A 14: 45,383,443 probably null Het
Inpp4a A C 1: 37,388,827 N651T possibly damaging Het
Ireb2 T C 9: 54,881,484 F81L possibly damaging Het
Kcnh3 T A 15: 99,239,928 probably null Het
Kmt2b CTCCTC CTCCTCATCCTC 7: 30,586,377 probably benign Het
Kmt2c TG TGCTGTGG 5: 25,315,772 probably benign Het
Myt1 T C 2: 181,797,773 S405P probably damaging Het
Net1 T C 13: 3,887,406 T245A probably benign Het
Nkx2-1 T C 12: 56,533,547 T203A probably damaging Het
Oas3 T C 5: 120,774,100 E75G probably damaging Het
Pappa T A 4: 65,323,873 D1491E probably benign Het
Pkhd1l1 C A 15: 44,503,238 T704K probably benign Het
Pkhd1l1 TT TTTTTTTTTGT 15: 44,558,507 probably benign Het
Ppp1r8 TCTCTCAC TC 4: 132,830,617 probably benign Het
Ppp2r3c T A 12: 55,293,815 I157F probably benign Het
Rspo4 C T 2: 151,867,877 probably null Het
Rtn4 T C 11: 29,706,919 S358P possibly damaging Het
Siglecg T A 7: 43,408,864 Y58* probably null Het
Slc4a1 C T 11: 102,356,716 probably null Het
Slc9b1 CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG 3: 135,357,542 probably benign Het
Smc2 T A 4: 52,442,276 D64E probably benign Het
Spaca1 CTCGC CTCGCTATCGC 4: 34,049,853 probably benign Het
Srrm2 A G 17: 23,812,588 S236G unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Strn TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC 17: 78,677,271 probably null Het
Tfeb CAG CAGGAG 17: 47,786,113 probably benign Het
Tktl2 A T 8: 66,512,852 E354V probably benign Het
Tpte A G 8: 22,306,943 T94A probably benign Het
Usp40 A C 1: 87,967,195 S868A possibly damaging Het
Vmn2r24 G A 6: 123,806,419 C526Y probably damaging Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Other mutations in Esf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Esf1 APN 2 140167817 missense probably benign 0.09
IGL01075:Esf1 APN 2 140120745 missense probably benign 0.01
IGL01777:Esf1 APN 2 140157172 splice site probably null
IGL01863:Esf1 APN 2 140120679 missense probably benign 0.00
IGL01982:Esf1 APN 2 140164528 missense probably benign 0.00
IGL02040:Esf1 APN 2 140129261 missense possibly damaging 0.70
IGL02063:Esf1 APN 2 140164457 missense possibly damaging 0.88
IGL03063:Esf1 APN 2 140154786 unclassified probably benign
PIT4418001:Esf1 UTSW 2 140159777 missense probably benign 0.18
R0255:Esf1 UTSW 2 140148923 unclassified probably benign
R0388:Esf1 UTSW 2 140120871 missense possibly damaging 0.71
R0564:Esf1 UTSW 2 140158586 missense possibly damaging 0.86
R0655:Esf1 UTSW 2 140148879 missense probably benign 0.25
R0831:Esf1 UTSW 2 140168359 missense probably damaging 1.00
R1642:Esf1 UTSW 2 140158486 missense possibly damaging 0.85
R1984:Esf1 UTSW 2 140148886 missense possibly damaging 0.83
R3981:Esf1 UTSW 2 140158556 missense probably benign 0.40
R4736:Esf1 UTSW 2 140124971 missense probably damaging 0.98
R5083:Esf1 UTSW 2 140157071 missense possibly damaging 0.93
R5083:Esf1 UTSW 2 140158579 missense possibly damaging 0.96
R5222:Esf1 UTSW 2 140158583 missense possibly damaging 0.86
R5347:Esf1 UTSW 2 140154881 nonsense probably null
R5654:Esf1 UTSW 2 140164228 missense possibly damaging 0.85
R6123:Esf1 UTSW 2 140168389 missense probably benign 0.01
R6132:Esf1 UTSW 2 140159779 missense probably benign 0.18
R6299:Esf1 UTSW 2 140123634 missense possibly damaging 0.53
R6484:Esf1 UTSW 2 140158538 missense probably benign 0.03
R6541:Esf1 UTSW 2 140167879 missense probably benign 0.00
R6674:Esf1 UTSW 2 140120806 nonsense probably null
R7203:Esf1 UTSW 2 140164219 missense possibly damaging 0.53
R7309:Esf1 UTSW 2 140125091 intron probably null
R7379:Esf1 UTSW 2 140154934 missense probably benign 0.33
R8131:Esf1 UTSW 2 140148831 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAAGTGTTACCTCATCAGCC -3'
(R):5'- CACAATATGCTGTAGTGGTTCC -3'

Sequencing Primer
(F):5'- CCGAGGAGCGTCTTTATCTAAC -3'
(R):5'- AGTGGTTCCAGTCATAATGGC -3'
Posted On2019-12-04