Incidental Mutation 'RF006:Myt1'
ID602807
Institutional Source Beutler Lab
Gene Symbol Myt1
Ensembl Gene ENSMUSG00000010505
Gene Namemyelin transcription factor 1
SynonymsNZF-2a, NZF-2b, Nzf2, Nztf2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF006 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181763332-181827797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181797773 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 405 (S405P)
Ref Sequence ENSEMBL: ENSMUSP00000079900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081125] [ENSMUST00000108756] [ENSMUST00000108757] [ENSMUST00000183403]
Predicted Effect probably damaging
Transcript: ENSMUST00000081125
AA Change: S405P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079900
Gene: ENSMUSG00000010505
AA Change: S405P

DomainStartEndE-ValueType
Pfam:zf-C2HC 71 99 8.7e-16 PFAM
low complexity region 155 160 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
coiled coil region 300 354 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Pfam:zf-C2HC 485 512 2.9e-14 PFAM
Pfam:zf-C2HC 529 557 4.3e-16 PFAM
Pfam:MYT1 604 660 2e-28 PFAM
Pfam:MYT1 659 835 2.3e-56 PFAM
Pfam:zf-C2HC 843 871 2e-18 PFAM
Pfam:zf-C2HC 887 915 1.9e-18 PFAM
Pfam:zf-C2HC 936 964 2.1e-16 PFAM
Pfam:zf-C2HC 989 1017 8.4e-16 PFAM
coiled coil region 1037 1109 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108756
AA Change: S363P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104387
Gene: ENSMUSG00000010505
AA Change: S363P

DomainStartEndE-ValueType
Pfam:zf-C2HC 27 57 5.1e-18 PFAM
low complexity region 113 118 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 258 312 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:zf-C2HC 441 471 5e-17 PFAM
Pfam:zf-C2HC 485 515 3.1e-18 PFAM
Pfam:MYT1 562 618 2.4e-32 PFAM
Pfam:MYT1 617 794 2e-74 PFAM
Pfam:zf-C2HC 799 829 1.9e-19 PFAM
Pfam:zf-C2HC 843 873 9.7e-20 PFAM
Pfam:zf-C2HC 892 922 2.2e-18 PFAM
Pfam:zf-C2HC 945 975 1.7e-16 PFAM
coiled coil region 995 1067 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108757
AA Change: S363P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104388
Gene: ENSMUSG00000010505
AA Change: S363P

DomainStartEndE-ValueType
Pfam:zf-C2HC 27 57 1e-17 PFAM
low complexity region 113 118 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 258 312 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:zf-C2HC 441 471 1e-16 PFAM
Pfam:zf-C2HC 485 510 6.2e-12 PFAM
Pfam:MYT1 524 580 2.7e-32 PFAM
Pfam:MYT1 579 756 2.3e-74 PFAM
Pfam:zf-C2HC 761 791 3.8e-19 PFAM
Pfam:zf-C2HC 805 835 1.9e-19 PFAM
Pfam:zf-C2HC 854 884 4.3e-18 PFAM
Pfam:zf-C2HC 907 937 3.3e-16 PFAM
coiled coil region 957 1029 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000115697
Gene: ENSMUSG00000010505
AA Change: S66P

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Pfam:zf-C2HC 147 174 6.2e-15 PFAM
Pfam:zf-C2HC 191 219 9.2e-17 PFAM
Pfam:MYT1 266 322 7.3e-29 PFAM
Pfam:MYT1 321 497 7.2e-57 PFAM
Pfam:zf-C2HC 505 533 9.6e-19 PFAM
Pfam:zf-C2HC 554 582 4.4e-17 PFAM
Pfam:zf-C2HC 607 635 1.8e-16 PFAM
coiled coil region 654 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129856
SMART Domains Protein: ENSMUSP00000122011
Gene: ENSMUSG00000010505

DomainStartEndE-ValueType
Pfam:zf-C2HC 63 91 1.4e-16 PFAM
low complexity region 147 152 N/A INTRINSIC
Pfam:zf-C2HC 177 204 4.6e-15 PFAM
Pfam:zf-C2HC 221 249 6.7e-17 PFAM
Pfam:MYT1 296 352 5.2e-29 PFAM
Pfam:MYT1 351 527 4.5e-57 PFAM
Pfam:zf-C2HC 535 556 1.4e-13 PFAM
Pfam:zf-C2HC 556 584 3.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183403
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This gene is a member of the myelin transcription factor 1 gene family. The encoded protein, a zinc finger DNA-binding protein, is involved in regulation of oligodendrocyte differentiation and proliferation in the developing central nervous system. The gene product has a role in remyelination through regeneration of oligodendrocyte lineage cells in response to demyelination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth displaying improper diaphragm innervation and a failture to initiate breathing; mutant embryonic pancreata contain abnormal islet cells that express multiple hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,352,649 I146F possibly damaging Het
4930548H24Rik C T 5: 31,487,550 Q216* probably null Het
Acbd7 GTT GT 2: 3,340,699 probably null Het
Acp7 A T 7: 28,614,779 N330K possibly damaging Het
Adam25 A T 8: 40,755,797 H700L probably benign Het
Alg9 GGGTGG GGGTGGTGG 9: 50,775,417 probably benign Het
Atp8b3 A T 10: 80,526,236 V689E probably benign Het
Atxn2l A G 7: 126,495,891 V533A probably benign Het
C87414 A T 5: 93,636,703 C301S probably benign Het
Catsperb G A 12: 101,575,979 probably null Het
Ccdc13 T C 9: 121,814,207 K376R probably damaging Het
Ccdc170 C CCAA 10: 4,561,030 probably benign Het
Cdh9 G C 15: 16,855,830 R652P probably damaging Het
Cenpf A C 1: 189,657,386 C1416W probably damaging Het
Chga GCA GCATCA 12: 102,561,412 probably benign Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA 9: 87,040,441 probably benign Het
Dennd3 T C 15: 73,547,592 I744T probably damaging Het
Dnah1 C T 14: 31,307,875 R491Q probably benign Het
Eif4a2 A T 16: 23,110,278 M188L possibly damaging Het
Esf1 CTCCTCTTC CTC 2: 140,164,374 probably benign Het
Fat3 T C 9: 15,998,617 I2030V probably benign Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gins4 A T 8: 23,227,167 V195E possibly damaging Het
Gm17402 TCCTCCTCC TCCTCCTCCCCCTCCTCC 3: 67,365,559 probably benign Het
Gm17604 CTCTCTTTC CTC X: 165,003,818 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,764 probably benign Het
Gnpnat1 T A 14: 45,383,443 probably null Het
Inpp4a A C 1: 37,388,827 N651T possibly damaging Het
Ireb2 T C 9: 54,881,484 F81L possibly damaging Het
Kcnh3 T A 15: 99,239,928 probably null Het
Kmt2b CTCCTC CTCCTCATCCTC 7: 30,586,377 probably benign Het
Kmt2c TG TGCTGTGG 5: 25,315,772 probably benign Het
Net1 T C 13: 3,887,406 T245A probably benign Het
Nkx2-1 T C 12: 56,533,547 T203A probably damaging Het
Oas3 T C 5: 120,774,100 E75G probably damaging Het
Pappa T A 4: 65,323,873 D1491E probably benign Het
Pkhd1l1 C A 15: 44,503,238 T704K probably benign Het
Pkhd1l1 TT TTTTTTTTTGT 15: 44,558,507 probably benign Het
Ppp1r8 TCTCTCAC TC 4: 132,830,617 probably benign Het
Ppp2r3c T A 12: 55,293,815 I157F probably benign Het
Rspo4 C T 2: 151,867,877 probably null Het
Rtn4 T C 11: 29,706,919 S358P possibly damaging Het
Siglecg T A 7: 43,408,864 Y58* probably null Het
Slc4a1 C T 11: 102,356,716 probably null Het
Slc9b1 CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG 3: 135,357,542 probably benign Het
Smc2 T A 4: 52,442,276 D64E probably benign Het
Spaca1 CTCGC CTCGCTATCGC 4: 34,049,853 probably benign Het
Srrm2 A G 17: 23,812,588 S236G unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Strn TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC 17: 78,677,271 probably null Het
Tfeb CAG CAGGAG 17: 47,786,113 probably benign Het
Tktl2 A T 8: 66,512,852 E354V probably benign Het
Tpte A G 8: 22,306,943 T94A probably benign Het
Usp40 A C 1: 87,967,195 S868A possibly damaging Het
Vmn2r24 G A 6: 123,806,419 C526Y probably damaging Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Other mutations in Myt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Myt1 APN 2 181801115 missense probably damaging 1.00
IGL00816:Myt1 APN 2 181807515 missense probably damaging 0.97
IGL01062:Myt1 APN 2 181797729 missense probably damaging 1.00
IGL01069:Myt1 APN 2 181825956 missense probably damaging 1.00
IGL01292:Myt1 APN 2 181805012 missense probably damaging 1.00
IGL01521:Myt1 APN 2 181825911 missense probably damaging 1.00
IGL01926:Myt1 APN 2 181821997 missense probably benign 0.00
IGL01976:Myt1 APN 2 181795739 missense probably damaging 1.00
IGL02066:Myt1 APN 2 181797189 missense probably damaging 1.00
IGL02109:Myt1 APN 2 181815617 splice site probably benign
IGL02209:Myt1 APN 2 181797234 missense probably benign 0.06
IGL02499:Myt1 APN 2 181825549 splice site probably benign
IGL03064:Myt1 APN 2 181797801 missense probably benign 0.31
IGL03394:Myt1 APN 2 181797845 missense probably damaging 1.00
PIT4366001:Myt1 UTSW 2 181825938 missense probably damaging 1.00
R0003:Myt1 UTSW 2 181801871 missense probably damaging 1.00
R0003:Myt1 UTSW 2 181801871 missense probably damaging 1.00
R0362:Myt1 UTSW 2 181763393 unclassified probably benign
R0627:Myt1 UTSW 2 181795689 missense probably benign 0.10
R0650:Myt1 UTSW 2 181782615 nonsense probably null
R0735:Myt1 UTSW 2 181807387 unclassified probably benign
R0744:Myt1 UTSW 2 181797505 intron probably benign
R1115:Myt1 UTSW 2 181811231 nonsense probably null
R1460:Myt1 UTSW 2 181802932 missense probably damaging 1.00
R1471:Myt1 UTSW 2 181797111 missense probably benign
R1836:Myt1 UTSW 2 181797275 missense probably benign
R1905:Myt1 UTSW 2 181797756 missense probably damaging 1.00
R2007:Myt1 UTSW 2 181795759 missense probably benign
R2040:Myt1 UTSW 2 181825924 missense probably damaging 1.00
R2140:Myt1 UTSW 2 181825979 missense probably damaging 1.00
R2323:Myt1 UTSW 2 181806557 missense probably damaging 1.00
R2926:Myt1 UTSW 2 181826010 missense possibly damaging 0.93
R3895:Myt1 UTSW 2 181820070 missense probably damaging 1.00
R4093:Myt1 UTSW 2 181811398 missense probably damaging 1.00
R4649:Myt1 UTSW 2 181797414 missense probably benign
R4693:Myt1 UTSW 2 181795739 missense probably damaging 1.00
R4775:Myt1 UTSW 2 181822677 missense probably damaging 1.00
R4835:Myt1 UTSW 2 181797462 missense probably damaging 0.99
R5111:Myt1 UTSW 2 181795885 missense probably benign 0.01
R5120:Myt1 UTSW 2 181797620 missense probably benign 0.25
R5622:Myt1 UTSW 2 181797122 missense probably benign
R6457:Myt1 UTSW 2 181763425 splice site probably null
R6704:Myt1 UTSW 2 181811212 start codon destroyed probably null
R6752:Myt1 UTSW 2 181801082 missense probably damaging 1.00
R6944:Myt1 UTSW 2 181797594 missense possibly damaging 0.52
R7337:Myt1 UTSW 2 181802963 missense possibly damaging 0.71
R7362:Myt1 UTSW 2 181797240 missense probably benign 0.00
R7368:Myt1 UTSW 2 181782591 missense possibly damaging 0.53
R7385:Myt1 UTSW 2 181767705 splice site probably null
R7411:Myt1 UTSW 2 181815106 missense probably damaging 1.00
R7593:Myt1 UTSW 2 181797739 missense possibly damaging 0.54
R7790:Myt1 UTSW 2 181797597 missense probably benign 0.00
R8035:Myt1 UTSW 2 181795739 missense probably damaging 1.00
R8156:Myt1 UTSW 2 181822761 critical splice donor site probably null
R8338:Myt1 UTSW 2 181801862 missense possibly damaging 0.94
Z1177:Myt1 UTSW 2 181797162 missense probably damaging 0.97
Z1177:Myt1 UTSW 2 181807602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAAAGGAGTCCTAGGTC -3'
(R):5'- ATCAGAGCAGGCCACTTTAG -3'

Sequencing Primer
(F):5'- AGTCCTAGGTCATGAGGAGG -3'
(R):5'- TTCCTCACCACGTCCAGGG -3'
Posted On2019-12-04