Incidental Mutation 'RF006:Smc2'
ID602811
Institutional Source Beutler Lab
Gene Symbol Smc2
Ensembl Gene ENSMUSG00000028312
Gene Namestructural maintenance of chromosomes 2
SynonymsCAP-E, Fin16, 5730502P04Rik, Smc2l1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #RF006 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location52439243-52488260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52442276 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 64 (D64E)
Ref Sequence ENSEMBL: ENSMUSP00000099979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102915] [ENSMUST00000117280] [ENSMUST00000142227]
PDB Structure
Crystal Structure of the Mouse Condensin Hinge Domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000102915
AA Change: D64E

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099979
Gene: ENSMUSG00000028312
AA Change: D64E

DomainStartEndE-ValueType
internal_repeat_1 146 174 2.4e-6 PROSPERO
low complexity region 183 207 N/A INTRINSIC
coiled coil region 238 355 N/A INTRINSIC
coiled coil region 400 503 N/A INTRINSIC
SMC_hinge 520 640 3.8e-34 SMART
coiled coil region 676 880 N/A INTRINSIC
coiled coil region 984 1031 N/A INTRINSIC
PDB:4I99|B 1034 1186 3e-15 PDB
SCOP:d1e69a_ 1066 1144 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117280
AA Change: D64E

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113940
Gene: ENSMUSG00000028312
AA Change: D64E

DomainStartEndE-ValueType
Pfam:AAA_21 27 131 3.8e-6 PFAM
internal_repeat_1 146 174 2.4e-6 PROSPERO
low complexity region 183 207 N/A INTRINSIC
coiled coil region 238 355 N/A INTRINSIC
coiled coil region 400 503 N/A INTRINSIC
SMC_hinge 520 640 3.8e-34 SMART
coiled coil region 676 880 N/A INTRINSIC
coiled coil region 984 1031 N/A INTRINSIC
PDB:4I99|B 1034 1186 3e-15 PDB
SCOP:d1e69a_ 1066 1144 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142227
AA Change: D64E

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114228
Gene: ENSMUSG00000028312
AA Change: D64E

DomainStartEndE-ValueType
Pfam:SMC_N 2 351 2.3e-36 PFAM
Pfam:AAA_21 27 131 1.7e-8 PFAM
coiled coil region 400 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: The protein encoded by this gene is a component of both condensin I and condensin II complexes, and forms a heterodimer with structural maintenance of chromosome 4 (Smc4). This heterodimer is the catalytic subunit for both condensin complexes, and is involved in several processes, including chromosome condensation during mitosis and meiosis, cohesin removal during mitosis and meiosis, and single-strand break (SSB) repair. Reduced expression of this gene results in chromosome segregation defects during mitosis and meiosis, with a more severe defect observed in embryonic stem cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice die embryonically. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,352,649 I146F possibly damaging Het
4930548H24Rik C T 5: 31,487,550 Q216* probably null Het
Acbd7 GTT GT 2: 3,340,699 probably null Het
Acp7 A T 7: 28,614,779 N330K possibly damaging Het
Adam25 A T 8: 40,755,797 H700L probably benign Het
Alg9 GGGTGG GGGTGGTGG 9: 50,775,417 probably benign Het
Atp8b3 A T 10: 80,526,236 V689E probably benign Het
Atxn2l A G 7: 126,495,891 V533A probably benign Het
C87414 A T 5: 93,636,703 C301S probably benign Het
Catsperb G A 12: 101,575,979 probably null Het
Ccdc13 T C 9: 121,814,207 K376R probably damaging Het
Ccdc170 C CCAA 10: 4,561,030 probably benign Het
Cdh9 G C 15: 16,855,830 R652P probably damaging Het
Cenpf A C 1: 189,657,386 C1416W probably damaging Het
Chga GCA GCATCA 12: 102,561,412 probably benign Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA 9: 87,040,441 probably benign Het
Dennd3 T C 15: 73,547,592 I744T probably damaging Het
Dnah1 C T 14: 31,307,875 R491Q probably benign Het
Eif4a2 A T 16: 23,110,278 M188L possibly damaging Het
Esf1 CTCCTCTTC CTC 2: 140,164,374 probably benign Het
Fat3 T C 9: 15,998,617 I2030V probably benign Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gins4 A T 8: 23,227,167 V195E possibly damaging Het
Gm17402 TCCTCCTCC TCCTCCTCCCCCTCCTCC 3: 67,365,559 probably benign Het
Gm17604 CTCTCTTTC CTC X: 165,003,818 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,764 probably benign Het
Gnpnat1 T A 14: 45,383,443 probably null Het
Inpp4a A C 1: 37,388,827 N651T possibly damaging Het
Ireb2 T C 9: 54,881,484 F81L possibly damaging Het
Kcnh3 T A 15: 99,239,928 probably null Het
Kmt2b CTCCTC CTCCTCATCCTC 7: 30,586,377 probably benign Het
Kmt2c TG TGCTGTGG 5: 25,315,772 probably benign Het
Myt1 T C 2: 181,797,773 S405P probably damaging Het
Net1 T C 13: 3,887,406 T245A probably benign Het
Nkx2-1 T C 12: 56,533,547 T203A probably damaging Het
Oas3 T C 5: 120,774,100 E75G probably damaging Het
Pappa T A 4: 65,323,873 D1491E probably benign Het
Pkhd1l1 C A 15: 44,503,238 T704K probably benign Het
Pkhd1l1 TT TTTTTTTTTGT 15: 44,558,507 probably benign Het
Ppp1r8 TCTCTCAC TC 4: 132,830,617 probably benign Het
Ppp2r3c T A 12: 55,293,815 I157F probably benign Het
Rspo4 C T 2: 151,867,877 probably null Het
Rtn4 T C 11: 29,706,919 S358P possibly damaging Het
Siglecg T A 7: 43,408,864 Y58* probably null Het
Slc4a1 C T 11: 102,356,716 probably null Het
Slc9b1 CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG 3: 135,357,542 probably benign Het
Spaca1 CTCGC CTCGCTATCGC 4: 34,049,853 probably benign Het
Srrm2 A G 17: 23,812,588 S236G unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Strn TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC 17: 78,677,271 probably null Het
Tfeb CAG CAGGAG 17: 47,786,113 probably benign Het
Tktl2 A T 8: 66,512,852 E354V probably benign Het
Tpte A G 8: 22,306,943 T94A probably benign Het
Usp40 A C 1: 87,967,195 S868A possibly damaging Het
Vmn2r24 G A 6: 123,806,419 C526Y probably damaging Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Other mutations in Smc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Smc2 APN 4 52450842 missense probably damaging 1.00
IGL02045:Smc2 APN 4 52462914 missense probably benign 0.01
IGL03013:Smc2 APN 4 52442280 missense probably damaging 1.00
IGL03031:Smc2 APN 4 52449638 missense probably benign 0.35
IGL03246:Smc2 APN 4 52440301 nonsense probably null
R0539:Smc2 UTSW 4 52458558 missense probably benign 0.01
R0782:Smc2 UTSW 4 52469799 missense probably benign 0.30
R1908:Smc2 UTSW 4 52450863 missense probably damaging 0.97
R2054:Smc2 UTSW 4 52462948 missense probably benign 0.00
R2109:Smc2 UTSW 4 52474987 missense probably benign 0.00
R2318:Smc2 UTSW 4 52446030 missense probably damaging 1.00
R2352:Smc2 UTSW 4 52460266 missense probably benign
R3418:Smc2 UTSW 4 52476850 splice site probably benign
R4003:Smc2 UTSW 4 52462897 missense probably damaging 1.00
R4133:Smc2 UTSW 4 52450947 missense probably damaging 0.99
R4299:Smc2 UTSW 4 52440238 utr 5 prime probably benign
R4547:Smc2 UTSW 4 52467866 missense probably benign 0.09
R4787:Smc2 UTSW 4 52462927 missense probably damaging 0.98
R4816:Smc2 UTSW 4 52451231 missense probably benign 0.00
R4829:Smc2 UTSW 4 52449612 missense probably damaging 0.98
R4861:Smc2 UTSW 4 52461090 missense probably benign 0.14
R4861:Smc2 UTSW 4 52461090 missense probably benign 0.14
R4951:Smc2 UTSW 4 52462926 missense possibly damaging 0.95
R4963:Smc2 UTSW 4 52450826 missense probably damaging 1.00
R4996:Smc2 UTSW 4 52461042 splice site probably null
R5028:Smc2 UTSW 4 52458447 missense probably damaging 0.96
R5103:Smc2 UTSW 4 52459033 missense probably damaging 1.00
R5159:Smc2 UTSW 4 52460181 missense possibly damaging 0.65
R5387:Smc2 UTSW 4 52475096 missense probably benign 0.16
R5697:Smc2 UTSW 4 52459045 missense probably benign 0.01
R6006:Smc2 UTSW 4 52459024 missense probably benign
R6246:Smc2 UTSW 4 52460289 missense probably damaging 1.00
R6321:Smc2 UTSW 4 52462814 missense probably benign
R6590:Smc2 UTSW 4 52449375 missense probably benign 0.01
R6658:Smc2 UTSW 4 52451322 missense probably benign 0.21
R6690:Smc2 UTSW 4 52449375 missense probably benign 0.01
R7422:Smc2 UTSW 4 52440301 missense probably benign 0.02
R7486:Smc2 UTSW 4 52462861 missense possibly damaging 0.54
R7487:Smc2 UTSW 4 52478448 missense probably damaging 1.00
R7532:Smc2 UTSW 4 52451013 missense probably damaging 1.00
R7556:Smc2 UTSW 4 52457379 missense probably benign 0.03
R7912:Smc2 UTSW 4 52450854 missense probably benign 0.00
R7993:Smc2 UTSW 4 52450854 missense probably benign 0.00
X0065:Smc2 UTSW 4 52440370 missense probably damaging 1.00
Z1176:Smc2 UTSW 4 52481682 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCTGACGGATGTGGC -3'
(R):5'- CCACTGCTGTATCATAGTGCAGT -3'

Sequencing Primer
(F):5'- GGCTGCCTGTTTTTACTTAACGTAAC -3'
(R):5'- TTACCAAGCTGCACTGTGG -3'
Posted On2019-12-04