Incidental Mutation 'RF006:Ppp1r8'
List |< first << previous [record 41 of 58] next >> last >|
ID602813
Institutional Source Beutler Lab
Gene Symbol Ppp1r8
Ensembl Gene ENSMUSG00000028882
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 8
SynonymsNIPP1, 6330548N22Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF006 (G1)
Quality Score194.468
Status Not validated
Chromosome4
Chromosomal Location132826929-132843169 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) TCTCTCAC to TC at 132830617 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030702] [ENSMUST00000105919]
PDB Structure
FHA domain of NIPP1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000030702
SMART Domains Protein: ENSMUSP00000030702
Gene: ENSMUSG00000028882

DomainStartEndE-ValueType
FHA 48 101 3.6e-15 SMART
low complexity region 144 164 N/A INTRINSIC
PDB:3V4Y|H 165 216 7e-29 PDB
low complexity region 239 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105919
SMART Domains Protein: ENSMUSP00000101539
Gene: ENSMUSG00000028882

DomainStartEndE-ValueType
FHA 48 101 7.37e-13 SMART
low complexity region 144 164 N/A INTRINSIC
PDB:3V4Y|H 165 216 7e-29 PDB
low complexity region 238 250 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, through alternative splicing, encodes three different isoforms. Two of the protein isoforms encoded by this gene are specific inhibitors of type 1 serine/threonine protein phosphatases and can bind but not cleave RNA. The third protein isoform lacks the phosphatase inhibitory function but is a single-strand endoribonuclease comparable to RNase E of E. coli. This isoform requires magnesium for its function and cleaves specific sites in A+U-rich regions of RNA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for knock-out allele exhibit severe growth retardation and impaired cell proliferation and die between embryonic days 6.5 and 7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,352,649 I146F possibly damaging Het
4930548H24Rik C T 5: 31,487,550 Q216* probably null Het
Acbd7 GTT GT 2: 3,340,699 probably null Het
Acp7 A T 7: 28,614,779 N330K possibly damaging Het
Adam25 A T 8: 40,755,797 H700L probably benign Het
Alg9 GGGTGG GGGTGGTGG 9: 50,775,417 probably benign Het
Atp8b3 A T 10: 80,526,236 V689E probably benign Het
Atxn2l A G 7: 126,495,891 V533A probably benign Het
C87414 A T 5: 93,636,703 C301S probably benign Het
Catsperb G A 12: 101,575,979 probably null Het
Ccdc13 T C 9: 121,814,207 K376R probably damaging Het
Ccdc170 C CCAA 10: 4,561,030 probably benign Het
Cdh9 G C 15: 16,855,830 R652P probably damaging Het
Cenpf A C 1: 189,657,386 C1416W probably damaging Het
Chga GCA GCATCA 12: 102,561,412 probably benign Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA 9: 87,040,441 probably benign Het
Dennd3 T C 15: 73,547,592 I744T probably damaging Het
Dnah1 C T 14: 31,307,875 R491Q probably benign Het
Eif4a2 A T 16: 23,110,278 M188L possibly damaging Het
Esf1 CTCCTCTTC CTC 2: 140,164,374 probably benign Het
Fat3 T C 9: 15,998,617 I2030V probably benign Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gins4 A T 8: 23,227,167 V195E possibly damaging Het
Gm17402 TCCTCCTCC TCCTCCTCCCCCTCCTCC 3: 67,365,559 probably benign Het
Gm17604 CTCTCTTTC CTC X: 165,003,818 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,764 probably benign Het
Gnpnat1 T A 14: 45,383,443 probably null Het
Inpp4a A C 1: 37,388,827 N651T possibly damaging Het
Ireb2 T C 9: 54,881,484 F81L possibly damaging Het
Kcnh3 T A 15: 99,239,928 probably null Het
Kmt2b CTCCTC CTCCTCATCCTC 7: 30,586,377 probably benign Het
Kmt2c TG TGCTGTGG 5: 25,315,772 probably benign Het
Myt1 T C 2: 181,797,773 S405P probably damaging Het
Net1 T C 13: 3,887,406 T245A probably benign Het
Nkx2-1 T C 12: 56,533,547 T203A probably damaging Het
Oas3 T C 5: 120,774,100 E75G probably damaging Het
Pappa T A 4: 65,323,873 D1491E probably benign Het
Pkhd1l1 C A 15: 44,503,238 T704K probably benign Het
Pkhd1l1 TT TTTTTTTTTGT 15: 44,558,507 probably benign Het
Ppp2r3c T A 12: 55,293,815 I157F probably benign Het
Rspo4 C T 2: 151,867,877 probably null Het
Rtn4 T C 11: 29,706,919 S358P possibly damaging Het
Siglecg T A 7: 43,408,864 Y58* probably null Het
Slc4a1 C T 11: 102,356,716 probably null Het
Slc9b1 CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG 3: 135,357,542 probably benign Het
Smc2 T A 4: 52,442,276 D64E probably benign Het
Spaca1 CTCGC CTCGCTATCGC 4: 34,049,853 probably benign Het
Srrm2 A G 17: 23,812,588 S236G unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Strn TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC 17: 78,677,271 probably null Het
Tfeb CAG CAGGAG 17: 47,786,113 probably benign Het
Tktl2 A T 8: 66,512,852 E354V probably benign Het
Tpte A G 8: 22,306,943 T94A probably benign Het
Usp40 A C 1: 87,967,195 S868A possibly damaging Het
Vmn2r24 G A 6: 123,806,419 C526Y probably damaging Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Other mutations in Ppp1r8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ppp1r8 APN 4 132834681 missense probably damaging 1.00
IGL00897:Ppp1r8 APN 4 132827902 missense probably damaging 0.96
IGL01669:Ppp1r8 APN 4 132828169 missense probably benign 0.02
IGL02663:Ppp1r8 APN 4 132833108 missense probably damaging 1.00
R0358:Ppp1r8 UTSW 4 132834728 missense probably damaging 0.99
R1458:Ppp1r8 UTSW 4 132840631 splice site probably benign
R1630:Ppp1r8 UTSW 4 132829437 missense probably benign 0.18
R7883:Ppp1r8 UTSW 4 132834715 missense probably damaging 0.97
RF028:Ppp1r8 UTSW 4 132830615 critical splice donor site probably benign
Z1177:Ppp1r8 UTSW 4 132843091 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GCTGCCACTCTGTGTAACCATC -3'
(R):5'- GGTGTTTTCCCCATGAAACTC -3'

Sequencing Primer
(F):5'- ACTCTGTGTAACCATCTATCAGAGC -3'
(R):5'- AACTCCCTATGTATTAATTCTGGGC -3'
Posted On2019-12-04