Incidental Mutation 'RF006:C87414'
List |< first << previous [record 9 of 58] next >> last >|
ID602816
Institutional Source Beutler Lab
Gene Symbol C87414
Ensembl Gene ENSMUSG00000070686
Gene Nameexpressed sequence C87414
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #RF006 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location93634993-93671551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93636703 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 301 (C301S)
Ref Sequence ENSEMBL: ENSMUSP00000124780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076321] [ENSMUST00000159578] [ENSMUST00000160382] [ENSMUST00000162964]
Predicted Effect probably benign
Transcript: ENSMUST00000076321
AA Change: C104S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075662
Gene: ENSMUSG00000070686
AA Change: C104S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 67 191 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159578
Predicted Effect probably benign
Transcript: ENSMUST00000160382
Predicted Effect probably benign
Transcript: ENSMUST00000162964
AA Change: C301S

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124780
Gene: ENSMUSG00000070686
AA Change: C301S

DomainStartEndE-ValueType
SCOP:d1a4ya_ 199 388 1e-9 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,352,649 I146F possibly damaging Het
4930548H24Rik C T 5: 31,487,550 Q216* probably null Het
Acbd7 GTT GT 2: 3,340,699 probably null Het
Acp7 A T 7: 28,614,779 N330K possibly damaging Het
Adam25 A T 8: 40,755,797 H700L probably benign Het
Alg9 GGGTGG GGGTGGTGG 9: 50,775,417 probably benign Het
Atp8b3 A T 10: 80,526,236 V689E probably benign Het
Atxn2l A G 7: 126,495,891 V533A probably benign Het
Catsperb G A 12: 101,575,979 probably null Het
Ccdc13 T C 9: 121,814,207 K376R probably damaging Het
Ccdc170 C CCAA 10: 4,561,030 probably benign Het
Cdh9 G C 15: 16,855,830 R652P probably damaging Het
Cenpf A C 1: 189,657,386 C1416W probably damaging Het
Chga GCA GCATCA 12: 102,561,412 probably benign Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA 9: 87,040,441 probably benign Het
Dennd3 T C 15: 73,547,592 I744T probably damaging Het
Dnah1 C T 14: 31,307,875 R491Q probably benign Het
Eif4a2 A T 16: 23,110,278 M188L possibly damaging Het
Esf1 CTCCTCTTC CTC 2: 140,164,374 probably benign Het
Fat3 T C 9: 15,998,617 I2030V probably benign Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gins4 A T 8: 23,227,167 V195E possibly damaging Het
Gm17402 TCCTCCTCC TCCTCCTCCCCCTCCTCC 3: 67,365,559 probably benign Het
Gm17604 CTCTCTTTC CTC X: 165,003,818 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,764 probably benign Het
Gnpnat1 T A 14: 45,383,443 probably null Het
Inpp4a A C 1: 37,388,827 N651T possibly damaging Het
Ireb2 T C 9: 54,881,484 F81L possibly damaging Het
Kcnh3 T A 15: 99,239,928 probably null Het
Kmt2b CTCCTC CTCCTCATCCTC 7: 30,586,377 probably benign Het
Kmt2c TG TGCTGTGG 5: 25,315,772 probably benign Het
Myt1 T C 2: 181,797,773 S405P probably damaging Het
Net1 T C 13: 3,887,406 T245A probably benign Het
Nkx2-1 T C 12: 56,533,547 T203A probably damaging Het
Oas3 T C 5: 120,774,100 E75G probably damaging Het
Pappa T A 4: 65,323,873 D1491E probably benign Het
Pkhd1l1 C A 15: 44,503,238 T704K probably benign Het
Pkhd1l1 TT TTTTTTTTTGT 15: 44,558,507 probably benign Het
Ppp1r8 TCTCTCAC TC 4: 132,830,617 probably benign Het
Ppp2r3c T A 12: 55,293,815 I157F probably benign Het
Rspo4 C T 2: 151,867,877 probably null Het
Rtn4 T C 11: 29,706,919 S358P possibly damaging Het
Siglecg T A 7: 43,408,864 Y58* probably null Het
Slc4a1 C T 11: 102,356,716 probably null Het
Slc9b1 CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG 3: 135,357,542 probably benign Het
Smc2 T A 4: 52,442,276 D64E probably benign Het
Spaca1 CTCGC CTCGCTATCGC 4: 34,049,853 probably benign Het
Srrm2 A G 17: 23,812,588 S236G unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Strn TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC 17: 78,677,271 probably null Het
Tfeb CAG CAGGAG 17: 47,786,113 probably benign Het
Tktl2 A T 8: 66,512,852 E354V probably benign Het
Tpte A G 8: 22,306,943 T94A probably benign Het
Usp40 A C 1: 87,967,195 S868A possibly damaging Het
Vmn2r24 G A 6: 123,806,419 C526Y probably damaging Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Other mutations in C87414
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:C87414 APN 5 93636477 missense probably damaging 1.00
IGL01642:C87414 APN 5 93636295 missense possibly damaging 0.84
IGL02735:C87414 APN 5 93638644 missense possibly damaging 0.94
PIT4466001:C87414 UTSW 5 93636288 missense probably damaging 1.00
R1830:C87414 UTSW 5 93637686 missense probably benign 0.03
R2071:C87414 UTSW 5 93636516 missense probably damaging 1.00
R4404:C87414 UTSW 5 93637713 missense possibly damaging 0.81
R4606:C87414 UTSW 5 93636602 missense probably damaging 0.96
R4672:C87414 UTSW 5 93636323 missense probably damaging 0.99
R5056:C87414 UTSW 5 93638925 start gained probably benign
R5118:C87414 UTSW 5 93637797 missense probably benign 0.03
R5288:C87414 UTSW 5 93637748 missense possibly damaging 0.86
R5441:C87414 UTSW 5 93636597 missense possibly damaging 0.84
R6190:C87414 UTSW 5 93638078 missense probably benign 0.14
R6513:C87414 UTSW 5 93637532 unclassified probably null
R7464:C87414 UTSW 5 93636240 missense probably damaging 1.00
R8130:C87414 UTSW 5 93636738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCTGGGAGTCCTTCATCC -3'
(R):5'- TTGGCATGAATGAGCAGATCC -3'

Sequencing Primer
(F):5'- GATCTGGGAGTCCTTCATCCTACAC -3'
(R):5'- TGAGCAGATCCAATAGTAAGCATC -3'
Posted On2019-12-04