Incidental Mutation 'RF006:Acp7'
List |< first << previous [record 4 of 58] next >> last >|
ID602819
Institutional Source Beutler Lab
Gene Symbol Acp7
Ensembl Gene ENSMUSG00000037469
Gene Nameacid phosphatase 7, tartrate resistant
SynonymsPapl, C330005M16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #RF006 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location28607634-28631332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28614779 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 330 (N330K)
Ref Sequence ENSEMBL: ENSMUSP00000045437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040112] [ENSMUST00000159418] [ENSMUST00000159560]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040112
AA Change: N330K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045437
Gene: ENSMUSG00000037469
AA Change: N330K

DomainStartEndE-ValueType
Pfam:Pur_ac_phosph_N 90 183 2.2e-19 PFAM
Pfam:Metallophos 192 395 6.4e-27 PFAM
Pfam:Metallophos_C 420 482 4.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159418
Predicted Effect probably benign
Transcript: ENSMUST00000159560
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purple acid phosphatases (PAPs), including PAPL, are a family of binuclear metallohydrolases that have been identified in plants, animals, and fungi (Flanagan et al., 2006 [PubMed 16793224]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,352,649 I146F possibly damaging Het
4930548H24Rik C T 5: 31,487,550 Q216* probably null Het
Acbd7 GTT GT 2: 3,340,699 probably null Het
Adam25 A T 8: 40,755,797 H700L probably benign Het
Alg9 GGGTGG GGGTGGTGG 9: 50,775,417 probably benign Het
Atp8b3 A T 10: 80,526,236 V689E probably benign Het
Atxn2l A G 7: 126,495,891 V533A probably benign Het
C87414 A T 5: 93,636,703 C301S probably benign Het
Catsperb G A 12: 101,575,979 probably null Het
Ccdc13 T C 9: 121,814,207 K376R probably damaging Het
Ccdc170 C CCAA 10: 4,561,030 probably benign Het
Cdh9 G C 15: 16,855,830 R652P probably damaging Het
Cenpf A C 1: 189,657,386 C1416W probably damaging Het
Chga GCA GCATCA 12: 102,561,412 probably benign Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA 9: 87,040,441 probably benign Het
Dennd3 T C 15: 73,547,592 I744T probably damaging Het
Dnah1 C T 14: 31,307,875 R491Q probably benign Het
Eif4a2 A T 16: 23,110,278 M188L possibly damaging Het
Esf1 CTCCTCTTC CTC 2: 140,164,374 probably benign Het
Fat3 T C 9: 15,998,617 I2030V probably benign Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gins4 A T 8: 23,227,167 V195E possibly damaging Het
Gm17402 TCCTCCTCC TCCTCCTCCCCCTCCTCC 3: 67,365,559 probably benign Het
Gm17604 CTCTCTTTC CTC X: 165,003,818 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,764 probably benign Het
Gnpnat1 T A 14: 45,383,443 probably null Het
Inpp4a A C 1: 37,388,827 N651T possibly damaging Het
Ireb2 T C 9: 54,881,484 F81L possibly damaging Het
Kcnh3 T A 15: 99,239,928 probably null Het
Kmt2b CTCCTC CTCCTCATCCTC 7: 30,586,377 probably benign Het
Kmt2c TG TGCTGTGG 5: 25,315,772 probably benign Het
Myt1 T C 2: 181,797,773 S405P probably damaging Het
Net1 T C 13: 3,887,406 T245A probably benign Het
Nkx2-1 T C 12: 56,533,547 T203A probably damaging Het
Oas3 T C 5: 120,774,100 E75G probably damaging Het
Pappa T A 4: 65,323,873 D1491E probably benign Het
Pkhd1l1 C A 15: 44,503,238 T704K probably benign Het
Pkhd1l1 TT TTTTTTTTTGT 15: 44,558,507 probably benign Het
Ppp1r8 TCTCTCAC TC 4: 132,830,617 probably benign Het
Ppp2r3c T A 12: 55,293,815 I157F probably benign Het
Rspo4 C T 2: 151,867,877 probably null Het
Rtn4 T C 11: 29,706,919 S358P possibly damaging Het
Siglecg T A 7: 43,408,864 Y58* probably null Het
Slc4a1 C T 11: 102,356,716 probably null Het
Slc9b1 CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG 3: 135,357,542 probably benign Het
Smc2 T A 4: 52,442,276 D64E probably benign Het
Spaca1 CTCGC CTCGCTATCGC 4: 34,049,853 probably benign Het
Srrm2 A G 17: 23,812,588 S236G unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Strn TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC 17: 78,677,271 probably null Het
Tfeb CAG CAGGAG 17: 47,786,113 probably benign Het
Tktl2 A T 8: 66,512,852 E354V probably benign Het
Tpte A G 8: 22,306,943 T94A probably benign Het
Usp40 A C 1: 87,967,195 S868A possibly damaging Het
Vmn2r24 G A 6: 123,806,419 C526Y probably damaging Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Other mutations in Acp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acp7 APN 7 28614697 missense possibly damaging 0.79
IGL00808:Acp7 APN 7 28614952 missense probably damaging 1.00
IGL01085:Acp7 APN 7 28611053 missense probably damaging 1.00
IGL02123:Acp7 APN 7 28629489 missense probably benign
IGL02250:Acp7 APN 7 28629710 splice site probably benign
IGL02255:Acp7 APN 7 28614723 missense probably damaging 1.00
IGL02904:Acp7 APN 7 28608003 missense probably benign 0.11
IGL03110:Acp7 APN 7 28611039 missense probably benign 0.25
R0172:Acp7 UTSW 7 28615124 missense possibly damaging 0.95
R0360:Acp7 UTSW 7 28611128 splice site probably benign
R0364:Acp7 UTSW 7 28611128 splice site probably benign
R1616:Acp7 UTSW 7 28611078 missense probably damaging 1.00
R1973:Acp7 UTSW 7 28607989 missense probably damaging 1.00
R2077:Acp7 UTSW 7 28629482 missense probably damaging 1.00
R2125:Acp7 UTSW 7 28629549 missense probably damaging 0.99
R2256:Acp7 UTSW 7 28614413 missense probably damaging 0.98
R2257:Acp7 UTSW 7 28614413 missense probably damaging 0.98
R2696:Acp7 UTSW 7 28614576 missense probably benign 0.00
R3103:Acp7 UTSW 7 28610984 critical splice donor site probably null
R3753:Acp7 UTSW 7 28616660 missense probably damaging 1.00
R3833:Acp7 UTSW 7 28615094 missense probably benign 0.00
R4622:Acp7 UTSW 7 28614397 missense probably damaging 1.00
R4849:Acp7 UTSW 7 28615452 missense possibly damaging 0.82
R5364:Acp7 UTSW 7 28611023 missense probably benign 0.25
R5382:Acp7 UTSW 7 28615419 missense possibly damaging 0.80
R5665:Acp7 UTSW 7 28616543 missense probably benign 0.31
R5688:Acp7 UTSW 7 28616495 missense probably benign 0.20
R7278:Acp7 UTSW 7 28630882 missense unknown
R7295:Acp7 UTSW 7 28629530 missense possibly damaging 0.83
R7384:Acp7 UTSW 7 28615088 missense possibly damaging 0.89
R7875:Acp7 UTSW 7 28614727 missense probably damaging 1.00
R8227:Acp7 UTSW 7 28616648 missense probably damaging 1.00
X0018:Acp7 UTSW 7 28607981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAAGGTCTTCTAGCCCG -3'
(R):5'- ATCATCTCATTCTCCACTGAGG -3'

Sequencing Primer
(F):5'- AGGTCTTCTAGCCCGAACAACTTG -3'
(R):5'- AGGTATACTTCTTTCTGCACTATGG -3'
Posted On2019-12-04