Incidental Mutation 'RF006:Vmn2r58'
ID602821
Institutional Source Beutler Lab
Gene Symbol Vmn2r58
Ensembl Gene ENSMUSG00000090383
Gene Namevomeronasal 2, receptor 58
SynonymsEG628422
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #RF006 (G1)
Quality Score214.458
Status Not validated
Chromosome7
Chromosomal Location41836881-41872670 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAAAATGATGTAGCACTT to C at 41836959 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171671]
Predicted Effect probably null
Transcript: ENSMUST00000171671
SMART Domains Protein: ENSMUSP00000126966
Gene: ENSMUSG00000090383

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 8e-43 PFAM
Pfam:NCD3G 514 567 1.8e-23 PFAM
Pfam:7tm_3 597 835 2.9e-52 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,352,649 I146F possibly damaging Het
4930548H24Rik C T 5: 31,487,550 Q216* probably null Het
Acbd7 GTT GT 2: 3,340,699 probably null Het
Acp7 A T 7: 28,614,779 N330K possibly damaging Het
Adam25 A T 8: 40,755,797 H700L probably benign Het
Alg9 GGGTGG GGGTGGTGG 9: 50,775,417 probably benign Het
Atp8b3 A T 10: 80,526,236 V689E probably benign Het
Atxn2l A G 7: 126,495,891 V533A probably benign Het
C87414 A T 5: 93,636,703 C301S probably benign Het
Catsperb G A 12: 101,575,979 probably null Het
Ccdc13 T C 9: 121,814,207 K376R probably damaging Het
Ccdc170 C CCAA 10: 4,561,030 probably benign Het
Cdh9 G C 15: 16,855,830 R652P probably damaging Het
Cenpf A C 1: 189,657,386 C1416W probably damaging Het
Chga GCA GCATCA 12: 102,561,412 probably benign Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA 9: 87,040,441 probably benign Het
Dennd3 T C 15: 73,547,592 I744T probably damaging Het
Dnah1 C T 14: 31,307,875 R491Q probably benign Het
Eif4a2 A T 16: 23,110,278 M188L possibly damaging Het
Esf1 CTCCTCTTC CTC 2: 140,164,374 probably benign Het
Fat3 T C 9: 15,998,617 I2030V probably benign Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gins4 A T 8: 23,227,167 V195E possibly damaging Het
Gm17402 TCCTCCTCC TCCTCCTCCCCCTCCTCC 3: 67,365,559 probably benign Het
Gm17604 CTCTCTTTC CTC X: 165,003,818 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,764 probably benign Het
Gnpnat1 T A 14: 45,383,443 probably null Het
Inpp4a A C 1: 37,388,827 N651T possibly damaging Het
Ireb2 T C 9: 54,881,484 F81L possibly damaging Het
Kcnh3 T A 15: 99,239,928 probably null Het
Kmt2b CTCCTC CTCCTCATCCTC 7: 30,586,377 probably benign Het
Kmt2c TG TGCTGTGG 5: 25,315,772 probably benign Het
Myt1 T C 2: 181,797,773 S405P probably damaging Het
Net1 T C 13: 3,887,406 T245A probably benign Het
Nkx2-1 T C 12: 56,533,547 T203A probably damaging Het
Oas3 T C 5: 120,774,100 E75G probably damaging Het
Pappa T A 4: 65,323,873 D1491E probably benign Het
Pkhd1l1 C A 15: 44,503,238 T704K probably benign Het
Pkhd1l1 TT TTTTTTTTTGT 15: 44,558,507 probably benign Het
Ppp1r8 TCTCTCAC TC 4: 132,830,617 probably benign Het
Ppp2r3c T A 12: 55,293,815 I157F probably benign Het
Rspo4 C T 2: 151,867,877 probably null Het
Rtn4 T C 11: 29,706,919 S358P possibly damaging Het
Siglecg T A 7: 43,408,864 Y58* probably null Het
Slc4a1 C T 11: 102,356,716 probably null Het
Slc9b1 CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG 3: 135,357,542 probably benign Het
Smc2 T A 4: 52,442,276 D64E probably benign Het
Spaca1 CTCGC CTCGCTATCGC 4: 34,049,853 probably benign Het
Srrm2 A G 17: 23,812,588 S236G unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Strn TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC 17: 78,677,271 probably null Het
Tfeb CAG CAGGAG 17: 47,786,113 probably benign Het
Tktl2 A T 8: 66,512,852 E354V probably benign Het
Tpte A G 8: 22,306,943 T94A probably benign Het
Usp40 A C 1: 87,967,195 S868A possibly damaging Het
Vmn2r24 G A 6: 123,806,419 C526Y probably damaging Het
Other mutations in Vmn2r58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vmn2r58 APN 7 41864430 missense possibly damaging 0.53
IGL00924:Vmn2r58 APN 7 41837467 missense probably damaging 1.00
IGL01291:Vmn2r58 APN 7 41864511 missense probably benign 0.02
IGL01480:Vmn2r58 APN 7 41864692 missense probably benign 0.01
IGL01551:Vmn2r58 APN 7 41865279 missense probably damaging 0.97
IGL01591:Vmn2r58 APN 7 41865329 missense probably benign 0.03
IGL01940:Vmn2r58 APN 7 41837647 missense probably benign 0.00
IGL01994:Vmn2r58 APN 7 41836970 missense probably damaging 0.98
IGL02041:Vmn2r58 APN 7 41865279 missense probably damaging 0.97
IGL02222:Vmn2r58 APN 7 41864025 missense possibly damaging 0.81
IGL02317:Vmn2r58 APN 7 41837341 missense possibly damaging 0.89
IGL02614:Vmn2r58 APN 7 41837129 missense probably damaging 1.00
IGL02673:Vmn2r58 APN 7 41864658 missense possibly damaging 0.90
IGL03323:Vmn2r58 APN 7 41861871 missense probably benign 0.06
IGL03337:Vmn2r58 APN 7 41864386 missense possibly damaging 0.93
IGL03380:Vmn2r58 APN 7 41864450 missense probably benign 0.00
ANU05:Vmn2r58 UTSW 7 41864511 missense probably benign 0.02
R0138:Vmn2r58 UTSW 7 41837624 missense probably damaging 1.00
R0141:Vmn2r58 UTSW 7 41861885 missense probably benign 0.11
R0421:Vmn2r58 UTSW 7 41865204 missense probably benign 0.02
R0604:Vmn2r58 UTSW 7 41860576 missense possibly damaging 0.78
R0854:Vmn2r58 UTSW 7 41837138 missense probably damaging 1.00
R1413:Vmn2r58 UTSW 7 41863963 missense probably benign 0.01
R1441:Vmn2r58 UTSW 7 41837440 missense probably damaging 1.00
R1678:Vmn2r58 UTSW 7 41864056 missense probably benign 0.40
R1691:Vmn2r58 UTSW 7 41837489 missense possibly damaging 0.95
R1699:Vmn2r58 UTSW 7 41860527 missense probably benign
R1865:Vmn2r58 UTSW 7 41837258 missense possibly damaging 0.95
R2008:Vmn2r58 UTSW 7 41860500 missense probably damaging 1.00
R2036:Vmn2r58 UTSW 7 41863993 missense probably benign
R2202:Vmn2r58 UTSW 7 41864170 missense probably benign 0.07
R3787:Vmn2r58 UTSW 7 41864074 missense probably benign 0.01
R3883:Vmn2r58 UTSW 7 41864490 nonsense probably null
R3944:Vmn2r58 UTSW 7 41864461 missense probably benign 0.03
R3949:Vmn2r58 UTSW 7 41863924 missense probably benign 0.08
R4232:Vmn2r58 UTSW 7 41837587 missense possibly damaging 0.91
R4409:Vmn2r58 UTSW 7 41872627 missense possibly damaging 0.69
R4411:Vmn2r58 UTSW 7 41861936 missense possibly damaging 0.85
R4413:Vmn2r58 UTSW 7 41861936 missense possibly damaging 0.85
R4600:Vmn2r58 UTSW 7 41872622 missense probably benign 0.03
R4610:Vmn2r58 UTSW 7 41837693 missense probably benign
R4646:Vmn2r58 UTSW 7 41860511 missense probably damaging 0.96
R4793:Vmn2r58 UTSW 7 41865071 missense probably damaging 0.99
R4870:Vmn2r58 UTSW 7 41837215 missense possibly damaging 0.76
R4981:Vmn2r58 UTSW 7 41837461 missense probably damaging 1.00
R4993:Vmn2r58 UTSW 7 41837752 missense probably benign 0.00
R5024:Vmn2r58 UTSW 7 41864322 missense probably damaging 0.99
R5064:Vmn2r58 UTSW 7 41837110 missense probably damaging 0.99
R5330:Vmn2r58 UTSW 7 41863960 nonsense probably null
R5526:Vmn2r58 UTSW 7 41872645 missense probably benign 0.01
R5980:Vmn2r58 UTSW 7 41865056 missense possibly damaging 0.81
R6163:Vmn2r58 UTSW 7 41837401 missense probably benign 0.31
R6365:Vmn2r58 UTSW 7 41864183 missense probably benign 0.42
R6567:Vmn2r58 UTSW 7 41865249 missense probably benign 0.34
R6594:Vmn2r58 UTSW 7 41837111 missense possibly damaging 0.69
R6980:Vmn2r58 UTSW 7 41864238 missense possibly damaging 0.64
R7373:Vmn2r58 UTSW 7 41837788 missense probably damaging 1.00
R7458:Vmn2r58 UTSW 7 41837699 missense probably benign 0.06
R7630:Vmn2r58 UTSW 7 41864187 missense probably damaging 0.99
R7807:Vmn2r58 UTSW 7 41872486 missense probably benign 0.05
R8114:Vmn2r58 UTSW 7 41861968 missense probably damaging 1.00
R8232:Vmn2r58 UTSW 7 41864652 missense probably damaging 0.97
R8313:Vmn2r58 UTSW 7 41872528 missense probably benign 0.01
RF027:Vmn2r58 UTSW 7 41836959 frame shift probably null
Z1176:Vmn2r58 UTSW 7 41864365 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCATCAGGTTATGCCACAC -3'
(R):5'- GTTCCTGTCATTCAGCATGCAG -3'

Sequencing Primer
(F):5'- TATGCCACACTAATATAATCACGGG -3'
(R):5'- GTCATTCAGCATGCAGGTATTC -3'
Posted On2019-12-04