Incidental Mutation 'RF006:Ireb2'
ID602830
Institutional Source Beutler Lab
Gene Symbol Ireb2
Ensembl Gene ENSMUSG00000032293
Gene Nameiron responsive element binding protein 2
SynonymsD9Ertd85e, Irp2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF006 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location54863789-54912530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54881484 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 81 (F81L)
Ref Sequence ENSEMBL: ENSMUSP00000034843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034843]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034843
AA Change: F81L

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034843
Gene: ENSMUSG00000032293
AA Change: F81L

DomainStartEndE-ValueType
Pfam:Aconitase 59 155 6.5e-16 PFAM
Pfam:Aconitase 186 639 2e-129 PFAM
Pfam:Aconitase_C 767 896 1.5e-44 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in microcytic anemia, altered body iron homeostasis, and variable behavioral and neurological phenotypes that may include pathological signs of neurodegeneration or brain iron accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,352,649 I146F possibly damaging Het
4930548H24Rik C T 5: 31,487,550 Q216* probably null Het
Acbd7 GTT GT 2: 3,340,699 probably null Het
Acp7 A T 7: 28,614,779 N330K possibly damaging Het
Adam25 A T 8: 40,755,797 H700L probably benign Het
Alg9 GGGTGG GGGTGGTGG 9: 50,775,417 probably benign Het
Atp8b3 A T 10: 80,526,236 V689E probably benign Het
Atxn2l A G 7: 126,495,891 V533A probably benign Het
C87414 A T 5: 93,636,703 C301S probably benign Het
Catsperb G A 12: 101,575,979 probably null Het
Ccdc13 T C 9: 121,814,207 K376R probably damaging Het
Ccdc170 C CCAA 10: 4,561,030 probably benign Het
Cdh9 G C 15: 16,855,830 R652P probably damaging Het
Cenpf A C 1: 189,657,386 C1416W probably damaging Het
Chga GCA GCATCA 12: 102,561,412 probably benign Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA 9: 87,040,441 probably benign Het
Dennd3 T C 15: 73,547,592 I744T probably damaging Het
Dnah1 C T 14: 31,307,875 R491Q probably benign Het
Eif4a2 A T 16: 23,110,278 M188L possibly damaging Het
Esf1 CTCCTCTTC CTC 2: 140,164,374 probably benign Het
Fat3 T C 9: 15,998,617 I2030V probably benign Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gins4 A T 8: 23,227,167 V195E possibly damaging Het
Gm17402 TCCTCCTCC TCCTCCTCCCCCTCCTCC 3: 67,365,559 probably benign Het
Gm17604 CTCTCTTTC CTC X: 165,003,818 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,764 probably benign Het
Inpp4a A C 1: 37,388,827 N651T possibly damaging Het
Kcnh3 T A 15: 99,239,928 probably null Het
Kmt2b CTCCTC CTCCTCATCCTC 7: 30,586,377 probably benign Het
Kmt2c TG TGCTGTGG 5: 25,315,772 probably benign Het
Myt1 T C 2: 181,797,773 S405P probably damaging Het
Net1 T C 13: 3,887,406 T245A probably benign Het
Nkx2-1 T C 12: 56,533,547 T203A probably damaging Het
Oas3 T C 5: 120,774,100 E75G probably damaging Het
Pappa T A 4: 65,323,873 D1491E probably benign Het
Pkhd1l1 C A 15: 44,503,238 T704K probably benign Het
Pkhd1l1 TT TTTTTTTTTGT 15: 44,558,507 probably benign Het
Ppp1r8 TCTCTCAC TC 4: 132,830,617 probably benign Het
Ppp2r3c T A 12: 55,293,815 I157F probably benign Het
Rtn4 T C 11: 29,706,919 S358P possibly damaging Het
Siglecg T A 7: 43,408,864 Y58* probably null Het
Slc4a1 C T 11: 102,356,716 probably null Het
Slc9b1 CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG 3: 135,357,542 probably benign Het
Smc2 T A 4: 52,442,276 D64E probably benign Het
Spaca1 CTCGC CTCGCTATCGC 4: 34,049,853 probably benign Het
Srrm2 A G 17: 23,812,588 S236G unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Strn TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC 17: 78,677,271 probably null Het
Tfeb CAG CAGGAG 17: 47,786,113 probably benign Het
Tktl2 A T 8: 66,512,852 E354V probably benign Het
Tpte A G 8: 22,306,943 T94A probably benign Het
Usp40 A C 1: 87,967,195 S868A possibly damaging Het
Vmn2r24 G A 6: 123,806,419 C526Y probably damaging Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Other mutations in Ireb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ireb2 APN 9 54899482 splice site probably benign
IGL01576:Ireb2 APN 9 54892510 missense probably damaging 1.00
IGL01844:Ireb2 APN 9 54865357 missense probably benign 0.01
homicidal UTSW 9 54886567 nonsense probably null
remorseless UTSW 9 54882333 missense possibly damaging 0.83
tony_stark UTSW 9 54903961 missense probably damaging 1.00
R0143:Ireb2 UTSW 9 54885909 missense probably benign 0.06
R0279:Ireb2 UTSW 9 54886593 missense probably benign
R0400:Ireb2 UTSW 9 54896498 missense probably benign
R0565:Ireb2 UTSW 9 54899983 missense probably damaging 1.00
R0686:Ireb2 UTSW 9 54904176 missense probably benign 0.44
R0706:Ireb2 UTSW 9 54892486 missense probably benign
R0894:Ireb2 UTSW 9 54896577 missense probably damaging 1.00
R1101:Ireb2 UTSW 9 54909702 missense probably benign 0.35
R1680:Ireb2 UTSW 9 54881518 missense probably damaging 1.00
R2074:Ireb2 UTSW 9 54881449 missense probably benign
R2080:Ireb2 UTSW 9 54896552 missense possibly damaging 0.85
R2891:Ireb2 UTSW 9 54899990 missense probably benign 0.01
R3153:Ireb2 UTSW 9 54885946 critical splice donor site probably null
R3154:Ireb2 UTSW 9 54885946 critical splice donor site probably null
R3844:Ireb2 UTSW 9 54892505 missense probably damaging 0.99
R4128:Ireb2 UTSW 9 54881432 missense probably benign 0.32
R4803:Ireb2 UTSW 9 54906814 missense probably benign 0.01
R5097:Ireb2 UTSW 9 54895384 missense probably benign 0.04
R5159:Ireb2 UTSW 9 54892547 missense probably benign
R5227:Ireb2 UTSW 9 54896601 critical splice donor site probably null
R5767:Ireb2 UTSW 9 54900516 missense probably benign
R6005:Ireb2 UTSW 9 54908805 missense probably damaging 1.00
R6127:Ireb2 UTSW 9 54882368 missense probably benign
R6155:Ireb2 UTSW 9 54886527 missense probably damaging 1.00
R6170:Ireb2 UTSW 9 54887372 missense probably benign 0.00
R6341:Ireb2 UTSW 9 54908780 missense probably damaging 0.99
R6707:Ireb2 UTSW 9 54903961 missense probably damaging 1.00
R6973:Ireb2 UTSW 9 54882387 missense probably benign 0.00
R7108:Ireb2 UTSW 9 54906641 missense probably damaging 1.00
R7126:Ireb2 UTSW 9 54886567 nonsense probably null
R7314:Ireb2 UTSW 9 54892510 missense probably damaging 1.00
R7396:Ireb2 UTSW 9 54882333 missense possibly damaging 0.83
R7472:Ireb2 UTSW 9 54884054 missense probably benign 0.11
R7590:Ireb2 UTSW 9 54896495 missense probably benign 0.00
R7842:Ireb2 UTSW 9 54909686 missense probably benign 0.01
R7894:Ireb2 UTSW 9 54882336 missense probably damaging 1.00
R7925:Ireb2 UTSW 9 54909686 missense probably benign 0.01
R7977:Ireb2 UTSW 9 54882336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGACATGACTTCTTGTTTACGG -3'
(R):5'- CAGAACAAGAAGGGTCAGTCTTTCAG -3'

Sequencing Primer
(F):5'- TGGAAGCTGCTGTACGAA -3'
(R):5'- AAGGGTCAGTCTTTCAGGATAC -3'
Posted On2019-12-04