Incidental Mutation 'RF006:Ccdc13'
List |< first << previous [record 11 of 58] next >> last >|
ID602834
Institutional Source Beutler Lab
Gene Symbol Ccdc13
Ensembl Gene ENSMUSG00000079235
Gene Namecoiled-coil domain containing 13
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #RF006 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location121797627-121839461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121814207 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 376 (K376R)
Ref Sequence ENSEMBL: ENSMUSP00000114787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135986] [ENSMUST00000142783] [ENSMUST00000155511]
Predicted Effect probably damaging
Transcript: ENSMUST00000135986
AA Change: K376R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114787
Gene: ENSMUSG00000079235
AA Change: K376R

DomainStartEndE-ValueType
coiled coil region 19 46 N/A INTRINSIC
coiled coil region 70 103 N/A INTRINSIC
coiled coil region 139 178 N/A INTRINSIC
coiled coil region 206 248 N/A INTRINSIC
low complexity region 293 304 N/A INTRINSIC
coiled coil region 323 370 N/A INTRINSIC
coiled coil region 428 458 N/A INTRINSIC
coiled coil region 550 604 N/A INTRINSIC
coiled coil region 648 670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142783
SMART Domains Protein: ENSMUSP00000130887
Gene: ENSMUSG00000079235

DomainStartEndE-ValueType
coiled coil region 68 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155511
Meta Mutation Damage Score 0.1123 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,352,649 I146F possibly damaging Het
4930548H24Rik C T 5: 31,487,550 Q216* probably null Het
Acbd7 GTT GT 2: 3,340,699 probably null Het
Acp7 A T 7: 28,614,779 N330K possibly damaging Het
Adam25 A T 8: 40,755,797 H700L probably benign Het
Alg9 GGGTGG GGGTGGTGG 9: 50,775,417 probably benign Het
Atp8b3 A T 10: 80,526,236 V689E probably benign Het
Atxn2l A G 7: 126,495,891 V533A probably benign Het
C87414 A T 5: 93,636,703 C301S probably benign Het
Catsperb G A 12: 101,575,979 probably null Het
Ccdc170 C CCAA 10: 4,561,030 probably benign Het
Cdh9 G C 15: 16,855,830 R652P probably damaging Het
Cenpf A C 1: 189,657,386 C1416W probably damaging Het
Chga GCA GCATCA 12: 102,561,412 probably benign Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA 9: 87,040,441 probably benign Het
Dennd3 T C 15: 73,547,592 I744T probably damaging Het
Dnah1 C T 14: 31,307,875 R491Q probably benign Het
Eif4a2 A T 16: 23,110,278 M188L possibly damaging Het
Esf1 CTCCTCTTC CTC 2: 140,164,374 probably benign Het
Fat3 T C 9: 15,998,617 I2030V probably benign Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gins4 A T 8: 23,227,167 V195E possibly damaging Het
Gm17402 TCCTCCTCC TCCTCCTCCCCCTCCTCC 3: 67,365,559 probably benign Het
Gm17604 CTCTCTTTC CTC X: 165,003,818 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,764 probably benign Het
Gnpnat1 T A 14: 45,383,443 probably null Het
Inpp4a A C 1: 37,388,827 N651T possibly damaging Het
Ireb2 T C 9: 54,881,484 F81L possibly damaging Het
Kcnh3 T A 15: 99,239,928 probably null Het
Kmt2b CTCCTC CTCCTCATCCTC 7: 30,586,377 probably benign Het
Kmt2c TG TGCTGTGG 5: 25,315,772 probably benign Het
Myt1 T C 2: 181,797,773 S405P probably damaging Het
Net1 T C 13: 3,887,406 T245A probably benign Het
Nkx2-1 T C 12: 56,533,547 T203A probably damaging Het
Oas3 T C 5: 120,774,100 E75G probably damaging Het
Pappa T A 4: 65,323,873 D1491E probably benign Het
Pkhd1l1 C A 15: 44,503,238 T704K probably benign Het
Pkhd1l1 TT TTTTTTTTTGT 15: 44,558,507 probably benign Het
Ppp1r8 TCTCTCAC TC 4: 132,830,617 probably benign Het
Ppp2r3c T A 12: 55,293,815 I157F probably benign Het
Rspo4 C T 2: 151,867,877 probably null Het
Rtn4 T C 11: 29,706,919 S358P possibly damaging Het
Siglecg T A 7: 43,408,864 Y58* probably null Het
Slc4a1 C T 11: 102,356,716 probably null Het
Slc9b1 CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG 3: 135,357,542 probably benign Het
Smc2 T A 4: 52,442,276 D64E probably benign Het
Spaca1 CTCGC CTCGCTATCGC 4: 34,049,853 probably benign Het
Srrm2 A G 17: 23,812,588 S236G unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Strn TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC 17: 78,677,271 probably null Het
Tfeb CAG CAGGAG 17: 47,786,113 probably benign Het
Tktl2 A T 8: 66,512,852 E354V probably benign Het
Tpte A G 8: 22,306,943 T94A probably benign Het
Usp40 A C 1: 87,967,195 S868A possibly damaging Het
Vmn2r24 G A 6: 123,806,419 C526Y probably damaging Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Other mutations in Ccdc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Ccdc13 APN 9 121810084 splice site probably benign
IGL01306:Ccdc13 APN 9 121827363 missense probably benign 0.37
ANU23:Ccdc13 UTSW 9 121827363 missense probably benign 0.37
R0112:Ccdc13 UTSW 9 121813481 missense probably damaging 0.98
R0144:Ccdc13 UTSW 9 121827351 missense probably damaging 0.98
R0360:Ccdc13 UTSW 9 121798216 missense probably damaging 1.00
R0364:Ccdc13 UTSW 9 121798216 missense probably damaging 1.00
R1441:Ccdc13 UTSW 9 121813449 missense probably benign 0.44
R1674:Ccdc13 UTSW 9 121809142 missense probably damaging 1.00
R1691:Ccdc13 UTSW 9 121825068 splice site probably null
R1710:Ccdc13 UTSW 9 121819581 missense probably damaging 1.00
R3821:Ccdc13 UTSW 9 121831019 missense probably damaging 1.00
R3822:Ccdc13 UTSW 9 121831019 missense probably damaging 1.00
R3962:Ccdc13 UTSW 9 121798939 intron probably benign
R4695:Ccdc13 UTSW 9 121820760 missense probably damaging 1.00
R4758:Ccdc13 UTSW 9 121833734 missense possibly damaging 0.91
R5058:Ccdc13 UTSW 9 121817547 intron probably benign
R5283:Ccdc13 UTSW 9 121808188 missense probably damaging 1.00
R5436:Ccdc13 UTSW 9 121799043 missense probably benign 0.06
R5601:Ccdc13 UTSW 9 121800572 nonsense probably null
R5623:Ccdc13 UTSW 9 121833733 missense probably damaging 0.99
R5653:Ccdc13 UTSW 9 121798787 makesense probably null
R5665:Ccdc13 UTSW 9 121814290 missense probably damaging 0.99
R5975:Ccdc13 UTSW 9 121827235 missense probably benign 0.00
R6212:Ccdc13 UTSW 9 121798909 intron probably benign
R6213:Ccdc13 UTSW 9 121798909 intron probably benign
R6214:Ccdc13 UTSW 9 121798909 intron probably benign
R6215:Ccdc13 UTSW 9 121798909 intron probably benign
R6222:Ccdc13 UTSW 9 121798909 intron probably benign
R6223:Ccdc13 UTSW 9 121798909 intron probably benign
R6257:Ccdc13 UTSW 9 121798909 intron probably benign
R7053:Ccdc13 UTSW 9 121833838 missense probably damaging 0.97
R7664:Ccdc13 UTSW 9 121814213 missense probably benign 0.01
R7909:Ccdc13 UTSW 9 121833860 missense probably benign 0.01
R7990:Ccdc13 UTSW 9 121833860 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCAGTGAGTGTCCACAGAGG -3'
(R):5'- ATGAACATAGGCTGGCCCTC -3'

Sequencing Primer
(F):5'- TTGCTCCCCAGAGGTACAC -3'
(R):5'- GGCCCTCAGCTTTCATTTTCTAATAC -3'
Posted On2019-12-04