Incidental Mutation 'RF006:Atp8b3'
List |< first << previous [record 7 of 58] next >> last >|
ID602836
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene NameATPase, class I, type 8B, member 3
Synonyms1700042F02Rik, SAPLT, 1700056N23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #RF006 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80519584-80539124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80526236 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 689 (V689E)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]
Predicted Effect probably benign
Transcript: ENSMUST00000020383
AA Change: V689E

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: V689E

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220326
AA Change: V689E

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,352,649 I146F possibly damaging Het
4930548H24Rik C T 5: 31,487,550 Q216* probably null Het
Acbd7 GTT GT 2: 3,340,699 probably null Het
Acp7 A T 7: 28,614,779 N330K possibly damaging Het
Adam25 A T 8: 40,755,797 H700L probably benign Het
Alg9 GGGTGG GGGTGGTGG 9: 50,775,417 probably benign Het
Atxn2l A G 7: 126,495,891 V533A probably benign Het
C87414 A T 5: 93,636,703 C301S probably benign Het
Catsperb G A 12: 101,575,979 probably null Het
Ccdc13 T C 9: 121,814,207 K376R probably damaging Het
Ccdc170 C CCAA 10: 4,561,030 probably benign Het
Cdh9 G C 15: 16,855,830 R652P probably damaging Het
Cenpf A C 1: 189,657,386 C1416W probably damaging Het
Chga GCA GCATCA 12: 102,561,412 probably benign Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA 9: 87,040,441 probably benign Het
Dennd3 T C 15: 73,547,592 I744T probably damaging Het
Dnah1 C T 14: 31,307,875 R491Q probably benign Het
Eif4a2 A T 16: 23,110,278 M188L possibly damaging Het
Esf1 CTCCTCTTC CTC 2: 140,164,374 probably benign Het
Fat3 T C 9: 15,998,617 I2030V probably benign Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gins4 A T 8: 23,227,167 V195E possibly damaging Het
Gm17402 TCCTCCTCC TCCTCCTCCCCCTCCTCC 3: 67,365,559 probably benign Het
Gm17604 CTCTCTTTC CTC X: 165,003,818 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,764 probably benign Het
Gnpnat1 T A 14: 45,383,443 probably null Het
Inpp4a A C 1: 37,388,827 N651T possibly damaging Het
Ireb2 T C 9: 54,881,484 F81L possibly damaging Het
Kcnh3 T A 15: 99,239,928 probably null Het
Kmt2b CTCCTC CTCCTCATCCTC 7: 30,586,377 probably benign Het
Kmt2c TG TGCTGTGG 5: 25,315,772 probably benign Het
Myt1 T C 2: 181,797,773 S405P probably damaging Het
Net1 T C 13: 3,887,406 T245A probably benign Het
Nkx2-1 T C 12: 56,533,547 T203A probably damaging Het
Oas3 T C 5: 120,774,100 E75G probably damaging Het
Pappa T A 4: 65,323,873 D1491E probably benign Het
Pkhd1l1 C A 15: 44,503,238 T704K probably benign Het
Pkhd1l1 TT TTTTTTTTTGT 15: 44,558,507 probably benign Het
Ppp1r8 TCTCTCAC TC 4: 132,830,617 probably benign Het
Ppp2r3c T A 12: 55,293,815 I157F probably benign Het
Rspo4 C T 2: 151,867,877 probably null Het
Rtn4 T C 11: 29,706,919 S358P possibly damaging Het
Siglecg T A 7: 43,408,864 Y58* probably null Het
Slc4a1 C T 11: 102,356,716 probably null Het
Slc9b1 CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG 3: 135,357,542 probably benign Het
Smc2 T A 4: 52,442,276 D64E probably benign Het
Spaca1 CTCGC CTCGCTATCGC 4: 34,049,853 probably benign Het
Srrm2 A G 17: 23,812,588 S236G unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Strn TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC 17: 78,677,271 probably null Het
Tfeb CAG CAGGAG 17: 47,786,113 probably benign Het
Tktl2 A T 8: 66,512,852 E354V probably benign Het
Tpte A G 8: 22,306,943 T94A probably benign Het
Usp40 A C 1: 87,967,195 S868A possibly damaging Het
Vmn2r24 G A 6: 123,806,419 C526Y probably damaging Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80530987 missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80526164 splice site probably benign
IGL00904:Atp8b3 APN 10 80528764 missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80524376 missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80534229 splice site probably benign
IGL01448:Atp8b3 APN 10 80520422 missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80530968 nonsense probably null
IGL01754:Atp8b3 APN 10 80530961 splice site probably null
IGL01809:Atp8b3 APN 10 80520011 missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80521828 missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80527233 splice site probably benign
IGL02224:Atp8b3 APN 10 80525976 splice site probably benign
IGL02377:Atp8b3 APN 10 80520294 missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80530628 missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80530604 missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80534458 missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80530586 missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80526909 missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80520084 missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80534198 missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80531018 missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80520183 missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80532542 missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80525785 missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80532578 missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80521801 unclassified probably null
R1717:Atp8b3 UTSW 10 80528797 missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80530078 missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80525386 nonsense probably null
R2138:Atp8b3 UTSW 10 80527105 missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80530988 missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80526894 missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80534183 missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80519912 missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80526180 missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80529706 missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80523847 missense probably benign
R4518:Atp8b3 UTSW 10 80523847 missense probably benign
R4519:Atp8b3 UTSW 10 80523847 missense probably benign
R4619:Atp8b3 UTSW 10 80526024 missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80525623 missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80536770 unclassified probably null
R4774:Atp8b3 UTSW 10 80536322 missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80524354 missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80521842 missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80529699 missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80520173 missense probably benign
R5990:Atp8b3 UTSW 10 80525697 missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80529681 missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80520323 unclassified probably null
R6748:Atp8b3 UTSW 10 80525224 missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80526061 missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80520024 missense probably benign 0.02
R7051:Atp8b3 UTSW 10 80529718 missense probably damaging 0.99
R7052:Atp8b3 UTSW 10 80520024 missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80530092 missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80529629 critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80520146 missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80524406 missense probably damaging 0.99
R8077:Atp8b3 UTSW 10 80531024 missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80529816 missense probably damaging 0.96
Z1177:Atp8b3 UTSW 10 80531077 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGTGGGTCATCATTTTGAACGC -3'
(R):5'- CAGCCCTGTTATGACACACG -3'

Sequencing Primer
(F):5'- GGTCATCATTTTGAACGCCTTCTGG -3'
(R):5'- GTTATGACACACGGCCACTCTG -3'
Posted On2019-12-04