Incidental Mutation 'RF006:Ppp2r3c'
ID602839
Institutional Source Beutler Lab
Gene Symbol Ppp2r3c
Ensembl Gene ENSMUSG00000021022
Gene Nameprotein phosphatase 2, regulatory subunit B'', gamma
Synonyms4930511A21Rik, G5pr, G4-1, 5730412A08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #RF006 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location55278991-55302998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55293815 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 157 (I157F)
Ref Sequence ENSEMBL: ENSMUSP00000021410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021410]
Predicted Effect probably benign
Transcript: ENSMUST00000021410
AA Change: I157F

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021410
Gene: ENSMUSG00000021022
AA Change: I157F

DomainStartEndE-ValueType
PDB:4I5K|B 188 437 1e-25 PDB
SCOP:d1dgua_ 258 413 4e-8 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory subunit of the serine/threonine phosphatase, protein phosphatase 2. This protein is localized to both nuclear and cytoplasmic regions depending on cell cycle phase. Homozygous conditional knockout mice for this gene exhibit reduced numbers and impaired proliferation of immune system B cells. This protein may regulate the expression of the P-glycoprotein ATP-binding cassette transporter through its phosphatase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,352,649 I146F possibly damaging Het
4930548H24Rik C T 5: 31,487,550 Q216* probably null Het
Acbd7 GTT GT 2: 3,340,699 probably null Het
Acp7 A T 7: 28,614,779 N330K possibly damaging Het
Adam25 A T 8: 40,755,797 H700L probably benign Het
Alg9 GGGTGG GGGTGGTGG 9: 50,775,417 probably benign Het
Atp8b3 A T 10: 80,526,236 V689E probably benign Het
Atxn2l A G 7: 126,495,891 V533A probably benign Het
C87414 A T 5: 93,636,703 C301S probably benign Het
Catsperb G A 12: 101,575,979 probably null Het
Ccdc13 T C 9: 121,814,207 K376R probably damaging Het
Ccdc170 C CCAA 10: 4,561,030 probably benign Het
Cdh9 G C 15: 16,855,830 R652P probably damaging Het
Cenpf A C 1: 189,657,386 C1416W probably damaging Het
Chga GCA GCATCA 12: 102,561,412 probably benign Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA 9: 87,040,441 probably benign Het
Dennd3 T C 15: 73,547,592 I744T probably damaging Het
Dnah1 C T 14: 31,307,875 R491Q probably benign Het
Eif4a2 A T 16: 23,110,278 M188L possibly damaging Het
Esf1 CTCCTCTTC CTC 2: 140,164,374 probably benign Het
Fat3 T C 9: 15,998,617 I2030V probably benign Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gins4 A T 8: 23,227,167 V195E possibly damaging Het
Gm17402 TCCTCCTCC TCCTCCTCCCCCTCCTCC 3: 67,365,559 probably benign Het
Gm17604 CTCTCTTTC CTC X: 165,003,818 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,764 probably benign Het
Gnpnat1 T A 14: 45,383,443 probably null Het
Inpp4a A C 1: 37,388,827 N651T possibly damaging Het
Ireb2 T C 9: 54,881,484 F81L possibly damaging Het
Kcnh3 T A 15: 99,239,928 probably null Het
Kmt2b CTCCTC CTCCTCATCCTC 7: 30,586,377 probably benign Het
Kmt2c TG TGCTGTGG 5: 25,315,772 probably benign Het
Myt1 T C 2: 181,797,773 S405P probably damaging Het
Net1 T C 13: 3,887,406 T245A probably benign Het
Nkx2-1 T C 12: 56,533,547 T203A probably damaging Het
Oas3 T C 5: 120,774,100 E75G probably damaging Het
Pappa T A 4: 65,323,873 D1491E probably benign Het
Pkhd1l1 C A 15: 44,503,238 T704K probably benign Het
Pkhd1l1 TT TTTTTTTTTGT 15: 44,558,507 probably benign Het
Ppp1r8 TCTCTCAC TC 4: 132,830,617 probably benign Het
Rspo4 C T 2: 151,867,877 probably null Het
Rtn4 T C 11: 29,706,919 S358P possibly damaging Het
Siglecg T A 7: 43,408,864 Y58* probably null Het
Slc4a1 C T 11: 102,356,716 probably null Het
Slc9b1 CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG 3: 135,357,542 probably benign Het
Smc2 T A 4: 52,442,276 D64E probably benign Het
Spaca1 CTCGC CTCGCTATCGC 4: 34,049,853 probably benign Het
Srrm2 A G 17: 23,812,588 S236G unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Strn TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC 17: 78,677,271 probably null Het
Tfeb CAG CAGGAG 17: 47,786,113 probably benign Het
Tktl2 A T 8: 66,512,852 E354V probably benign Het
Tpte A G 8: 22,306,943 T94A probably benign Het
Usp40 A C 1: 87,967,195 S868A possibly damaging Het
Vmn2r24 G A 6: 123,806,419 C526Y probably damaging Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Other mutations in Ppp2r3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Ppp2r3c APN 12 55292498 splice site probably null
IGL01122:Ppp2r3c APN 12 55297802 missense probably benign 0.20
IGL01954:Ppp2r3c APN 12 55292568 missense probably damaging 1.00
IGL02939:Ppp2r3c APN 12 55298407 unclassified probably benign
R0045:Ppp2r3c UTSW 12 55293821 missense probably damaging 0.99
R0129:Ppp2r3c UTSW 12 55298422 missense probably damaging 0.96
R2411:Ppp2r3c UTSW 12 55298484 missense probably benign 0.19
R4468:Ppp2r3c UTSW 12 55297883 nonsense probably null
R4746:Ppp2r3c UTSW 12 55302635 unclassified probably null
R5499:Ppp2r3c UTSW 12 55288626 missense probably benign 0.09
R5724:Ppp2r3c UTSW 12 55297832 missense probably benign 0.45
R6724:Ppp2r3c UTSW 12 55288496 missense probably benign 0.02
R6776:Ppp2r3c UTSW 12 55298467 nonsense probably null
R7706:Ppp2r3c UTSW 12 55281705 missense probably benign 0.23
R7975:Ppp2r3c UTSW 12 55287993 nonsense probably null
R8111:Ppp2r3c UTSW 12 55297849 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAGCTCTGTCTGGTGTCTAG -3'
(R):5'- AGCTGTGAAGAGTCTTTATAGTCTC -3'

Sequencing Primer
(F):5'- AGCTCTGTCTGGTGTCTAGAAGAATC -3'
(R):5'- TGCTATCCAAAATCCCCTGTAC -3'
Posted On2019-12-04