Incidental Mutation 'RF006:Nkx2-1'
List |< first << previous [record 36 of 58] next >> last >|
ID602840
Institutional Source Beutler Lab
Gene Symbol Nkx2-1
Ensembl Gene ENSMUSG00000001496
Gene NameNK2 homeobox 1
Synonymsthyroid-specific enhancer-binding protein, Titf1, tinman, thyroid transcription factor-1, T/EBP, Ttf-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF006 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location56531958-56536908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56533547 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 203 (T203A)
Ref Sequence ENSEMBL: ENSMUSP00000001536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001536] [ENSMUST00000178477]
Predicted Effect probably damaging
Transcript: ENSMUST00000001536
AA Change: T203A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001536
Gene: ENSMUSG00000001496
AA Change: T203A

DomainStartEndE-ValueType
low complexity region 39 69 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
HOX 161 223 9.05e-25 SMART
low complexity region 224 254 N/A INTRINSIC
low complexity region 273 323 N/A INTRINSIC
low complexity region 346 356 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178477
AA Change: T203A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136103
Gene: ENSMUSG00000001496
AA Change: T203A

DomainStartEndE-ValueType
low complexity region 39 69 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
HOX 161 223 9.05e-25 SMART
low complexity region 224 254 N/A INTRINSIC
low complexity region 273 323 N/A INTRINSIC
low complexity region 346 356 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein initially identified as a thyroid-specific transcription factor. The encoded protein binds to the thyroglobulin promoter and regulates the expression of thyroid-specific genes but has also been shown to regulate the expression of genes involved in morphogenesis. Mutations and deletions in this gene are associated with benign hereditary chorea, choreoathetosis, congenital hypothyroidism, and neonatal respiratory distress, and may be associated with thyroid cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares the symbol/alias 'TTF1' with another gene, transcription termination factor 1, which plays a role in ribosomal gene transcription. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted mutation have profoundly abnormal lungs and ventral forebrain defects, lack thyroids, pituitary gland, and tracheoesophageal septation, and die at birth from respiratory failure. Carriers show incoordination and high TSH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,352,649 I146F possibly damaging Het
4930548H24Rik C T 5: 31,487,550 Q216* probably null Het
Acbd7 GTT GT 2: 3,340,699 probably null Het
Acp7 A T 7: 28,614,779 N330K possibly damaging Het
Adam25 A T 8: 40,755,797 H700L probably benign Het
Alg9 GGGTGG GGGTGGTGG 9: 50,775,417 probably benign Het
Atp8b3 A T 10: 80,526,236 V689E probably benign Het
Atxn2l A G 7: 126,495,891 V533A probably benign Het
C87414 A T 5: 93,636,703 C301S probably benign Het
Catsperb G A 12: 101,575,979 probably null Het
Ccdc13 T C 9: 121,814,207 K376R probably damaging Het
Ccdc170 C CCAA 10: 4,561,030 probably benign Het
Cdh9 G C 15: 16,855,830 R652P probably damaging Het
Cenpf A C 1: 189,657,386 C1416W probably damaging Het
Chga GCA GCATCA 12: 102,561,412 probably benign Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA 9: 87,040,441 probably benign Het
Dennd3 T C 15: 73,547,592 I744T probably damaging Het
Dnah1 C T 14: 31,307,875 R491Q probably benign Het
Eif4a2 A T 16: 23,110,278 M188L possibly damaging Het
Esf1 CTCCTCTTC CTC 2: 140,164,374 probably benign Het
Fat3 T C 9: 15,998,617 I2030V probably benign Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gins4 A T 8: 23,227,167 V195E possibly damaging Het
Gm17402 TCCTCCTCC TCCTCCTCCCCCTCCTCC 3: 67,365,559 probably benign Het
Gm17604 CTCTCTTTC CTC X: 165,003,818 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,764 probably benign Het
Gnpnat1 T A 14: 45,383,443 probably null Het
Inpp4a A C 1: 37,388,827 N651T possibly damaging Het
Ireb2 T C 9: 54,881,484 F81L possibly damaging Het
Kcnh3 T A 15: 99,239,928 probably null Het
Kmt2b CTCCTC CTCCTCATCCTC 7: 30,586,377 probably benign Het
Kmt2c TG TGCTGTGG 5: 25,315,772 probably benign Het
Myt1 T C 2: 181,797,773 S405P probably damaging Het
Net1 T C 13: 3,887,406 T245A probably benign Het
Oas3 T C 5: 120,774,100 E75G probably damaging Het
Pappa T A 4: 65,323,873 D1491E probably benign Het
Pkhd1l1 C A 15: 44,503,238 T704K probably benign Het
Pkhd1l1 TT TTTTTTTTTGT 15: 44,558,507 probably benign Het
Ppp1r8 TCTCTCAC TC 4: 132,830,617 probably benign Het
Ppp2r3c T A 12: 55,293,815 I157F probably benign Het
Rspo4 C T 2: 151,867,877 probably null Het
Rtn4 T C 11: 29,706,919 S358P possibly damaging Het
Siglecg T A 7: 43,408,864 Y58* probably null Het
Slc4a1 C T 11: 102,356,716 probably null Het
Slc9b1 CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG 3: 135,357,542 probably benign Het
Smc2 T A 4: 52,442,276 D64E probably benign Het
Spaca1 CTCGC CTCGCTATCGC 4: 34,049,853 probably benign Het
Srrm2 A G 17: 23,812,588 S236G unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Strn TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC 17: 78,677,271 probably null Het
Tfeb CAG CAGGAG 17: 47,786,113 probably benign Het
Tktl2 A T 8: 66,512,852 E354V probably benign Het
Tpte A G 8: 22,306,943 T94A probably benign Het
Usp40 A C 1: 87,967,195 S868A possibly damaging Het
Vmn2r24 G A 6: 123,806,419 C526Y probably damaging Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Other mutations in Nkx2-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0617:Nkx2-1 UTSW 12 56534855 missense possibly damaging 0.75
R1745:Nkx2-1 UTSW 12 56533744 missense probably benign 0.00
R2209:Nkx2-1 UTSW 12 56533508 missense probably benign 0.15
R2230:Nkx2-1 UTSW 12 56533286 nonsense probably null
R4691:Nkx2-1 UTSW 12 56533565 missense probably benign 0.01
R4990:Nkx2-1 UTSW 12 56534939 missense possibly damaging 0.72
R4991:Nkx2-1 UTSW 12 56534939 missense possibly damaging 0.72
R7216:Nkx2-1 UTSW 12 56534802 missense probably damaging 1.00
R7316:Nkx2-1 UTSW 12 56534798 missense probably benign 0.18
Z1176:Nkx2-1 UTSW 12 56533684 missense probably benign 0.00
Z1176:Nkx2-1 UTSW 12 56534964 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGCCGTCTTTGACTAGGAC -3'
(R):5'- TGAATATGAGTGGCATGGGC -3'

Sequencing Primer
(F):5'- TCTTTGACTAGGACCGGCAC -3'
(R):5'- GGGTGCTCTTCTCCCAG -3'
Posted On2019-12-04