Incidental Mutation 'RF006:Cdh9'
List |< first << previous [record 13 of 58] next >> last >|
ID602845
Institutional Source Beutler Lab
Gene Symbol Cdh9
Ensembl Gene ENSMUSG00000025370
Gene Namecadherin 9
SynonymsT1-cadherin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #RF006 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location16728756-16857094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 16855830 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 652 (R652P)
Ref Sequence ENSEMBL: ENSMUSP00000026432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026432] [ENSMUST00000228307]
Predicted Effect probably damaging
Transcript: ENSMUST00000026432
AA Change: R652P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026432
Gene: ENSMUSG00000025370
AA Change: R652P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 75 156 2.84e-15 SMART
CA 180 265 5.63e-28 SMART
CA 289 381 1.12e-13 SMART
CA 404 485 8.03e-24 SMART
CA 508 595 1.34e-2 SMART
transmembrane domain 613 635 N/A INTRINSIC
Pfam:Cadherin_C 638 782 1.5e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228307
AA Change: R652P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout results in the formation of abnormal axonal arbors in some retinal type 5 bipolar cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,352,649 I146F possibly damaging Het
4930548H24Rik C T 5: 31,487,550 Q216* probably null Het
Acbd7 GTT GT 2: 3,340,699 probably null Het
Acp7 A T 7: 28,614,779 N330K possibly damaging Het
Adam25 A T 8: 40,755,797 H700L probably benign Het
Alg9 GGGTGG GGGTGGTGG 9: 50,775,417 probably benign Het
Atp8b3 A T 10: 80,526,236 V689E probably benign Het
Atxn2l A G 7: 126,495,891 V533A probably benign Het
C87414 A T 5: 93,636,703 C301S probably benign Het
Catsperb G A 12: 101,575,979 probably null Het
Ccdc13 T C 9: 121,814,207 K376R probably damaging Het
Ccdc170 C CCAA 10: 4,561,030 probably benign Het
Cenpf A C 1: 189,657,386 C1416W probably damaging Het
Chga GCA GCATCA 12: 102,561,412 probably benign Het
Cyb5r4 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG 9: 87,040,425 probably benign Het
Cyb5r4 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA 9: 87,040,441 probably benign Het
Dennd3 T C 15: 73,547,592 I744T probably damaging Het
Dnah1 C T 14: 31,307,875 R491Q probably benign Het
Eif4a2 A T 16: 23,110,278 M188L possibly damaging Het
Esf1 CTCCTCTTC CTC 2: 140,164,374 probably benign Het
Fat3 T C 9: 15,998,617 I2030V probably benign Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gins4 A T 8: 23,227,167 V195E possibly damaging Het
Gm17402 TCCTCCTCC TCCTCCTCCCCCTCCTCC 3: 67,365,559 probably benign Het
Gm17604 CTCTCTTTC CTC X: 165,003,818 probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,764 probably benign Het
Gnpnat1 T A 14: 45,383,443 probably null Het
Inpp4a A C 1: 37,388,827 N651T possibly damaging Het
Ireb2 T C 9: 54,881,484 F81L possibly damaging Het
Kcnh3 T A 15: 99,239,928 probably null Het
Kmt2b CTCCTC CTCCTCATCCTC 7: 30,586,377 probably benign Het
Kmt2c TG TGCTGTGG 5: 25,315,772 probably benign Het
Myt1 T C 2: 181,797,773 S405P probably damaging Het
Net1 T C 13: 3,887,406 T245A probably benign Het
Nkx2-1 T C 12: 56,533,547 T203A probably damaging Het
Oas3 T C 5: 120,774,100 E75G probably damaging Het
Pappa T A 4: 65,323,873 D1491E probably benign Het
Pkhd1l1 C A 15: 44,503,238 T704K probably benign Het
Pkhd1l1 TT TTTTTTTTTGT 15: 44,558,507 probably benign Het
Ppp1r8 TCTCTCAC TC 4: 132,830,617 probably benign Het
Ppp2r3c T A 12: 55,293,815 I157F probably benign Het
Rspo4 C T 2: 151,867,877 probably null Het
Rtn4 T C 11: 29,706,919 S358P possibly damaging Het
Siglecg T A 7: 43,408,864 Y58* probably null Het
Slc4a1 C T 11: 102,356,716 probably null Het
Slc9b1 CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG 3: 135,357,542 probably benign Het
Smc2 T A 4: 52,442,276 D64E probably benign Het
Spaca1 CTCGC CTCGCTATCGC 4: 34,049,853 probably benign Het
Srrm2 A G 17: 23,812,588 S236G unknown Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Strn TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC 17: 78,677,271 probably null Het
Tfeb CAG CAGGAG 17: 47,786,113 probably benign Het
Tktl2 A T 8: 66,512,852 E354V probably benign Het
Tpte A G 8: 22,306,943 T94A probably benign Het
Usp40 A C 1: 87,967,195 S868A possibly damaging Het
Vmn2r24 G A 6: 123,806,419 C526Y probably damaging Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Other mutations in Cdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cdh9 APN 15 16828362 missense probably damaging 1.00
IGL00555:Cdh9 APN 15 16823406 missense probably damaging 1.00
IGL01110:Cdh9 APN 15 16855926 missense possibly damaging 0.63
IGL01432:Cdh9 APN 15 16830947 missense probably damaging 1.00
IGL01768:Cdh9 APN 15 16778225 missense possibly damaging 0.51
IGL02043:Cdh9 APN 15 16856232 missense probably damaging 1.00
IGL02304:Cdh9 APN 15 16848601 missense probably benign 0.01
IGL02380:Cdh9 APN 15 16856000 missense possibly damaging 0.79
IGL02505:Cdh9 APN 15 16855989 missense probably damaging 1.00
IGL02675:Cdh9 APN 15 16849076 splice site probably null
IGL02679:Cdh9 APN 15 16832230 missense probably damaging 0.97
IGL03288:Cdh9 APN 15 16856049 missense probably damaging 1.00
R0426:Cdh9 UTSW 15 16823454 critical splice donor site probably null
R0726:Cdh9 UTSW 15 16831044 missense probably benign 0.00
R1335:Cdh9 UTSW 15 16850792 missense probably benign 0.00
R1368:Cdh9 UTSW 15 16848482 splice site probably benign
R1766:Cdh9 UTSW 15 16778306 missense probably damaging 1.00
R1916:Cdh9 UTSW 15 16823275 missense probably benign 0.03
R2325:Cdh9 UTSW 15 16778200 missense probably benign
R2424:Cdh9 UTSW 15 16850354 missense probably damaging 1.00
R3104:Cdh9 UTSW 15 16855814 missense probably damaging 1.00
R3837:Cdh9 UTSW 15 16823438 nonsense probably null
R3839:Cdh9 UTSW 15 16823438 nonsense probably null
R4241:Cdh9 UTSW 15 16849079 critical splice acceptor site probably null
R4248:Cdh9 UTSW 15 16850388 missense probably benign 0.00
R4576:Cdh9 UTSW 15 16832239 missense possibly damaging 0.73
R4679:Cdh9 UTSW 15 16850959 missense probably benign
R4896:Cdh9 UTSW 15 16778156 missense probably benign 0.12
R4961:Cdh9 UTSW 15 16850828 missense probably benign
R5050:Cdh9 UTSW 15 16778147 missense probably benign 0.12
R5089:Cdh9 UTSW 15 16778276 missense probably damaging 1.00
R5268:Cdh9 UTSW 15 16851013 missense probably benign
R5567:Cdh9 UTSW 15 16855844 missense probably damaging 1.00
R5646:Cdh9 UTSW 15 16823285 missense probably damaging 1.00
R5894:Cdh9 UTSW 15 16832100 missense possibly damaging 0.47
R6440:Cdh9 UTSW 15 16823423 missense probably benign 0.01
R6441:Cdh9 UTSW 15 16823423 missense probably benign 0.01
R7225:Cdh9 UTSW 15 16856073 missense probably damaging 1.00
R7247:Cdh9 UTSW 15 16778255 missense probably damaging 1.00
R7593:Cdh9 UTSW 15 16823175 missense probably damaging 1.00
R7615:Cdh9 UTSW 15 16856230 missense probably damaging 1.00
R7632:Cdh9 UTSW 15 16851029 splice site probably null
R8035:Cdh9 UTSW 15 16831066 missense probably damaging 0.97
X0062:Cdh9 UTSW 15 16848539 missense possibly damaging 0.81
Z1177:Cdh9 UTSW 15 16850364 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GTCTCTGTATCGTTCCAACTGG -3'
(R):5'- TCCGGTGTATAAAATCTTGTACGTC -3'

Sequencing Primer
(F):5'- CGTTCCAACTGGATAGTTATTCCATG -3'
(R):5'- GTACGTCAATATTTTCCCAGAGGG -3'
Posted On2019-12-04