Incidental Mutation 'RF007:Trim33'
ID602873
Institutional Source Beutler Lab
Gene Symbol Trim33
Ensembl Gene ENSMUSG00000033014
Gene Nametripartite motif-containing 33
Synonymsectodermin, Ecto, 8030451N04Rik, Tif1g
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF007 (G1)
Quality Score217.486
Status Not validated
Chromosome3
Chromosomal Location103279293-103358775 bp(+) (GRCm38)
Type of Mutationsmall deletion (2 aa in frame mutation)
DNA Base Change (assembly) GGCCCCCGC to GGC at 103280217 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029444] [ENSMUST00000106860]
Predicted Effect probably benign
Transcript: ENSMUST00000029444
SMART Domains Protein: ENSMUSP00000029444
Gene: ENSMUSG00000033014

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1095 3.74e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106860
SMART Domains Protein: ENSMUSP00000102473
Gene: ENSMUSG00000033014

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
low complexity region 33 134 N/A INTRINSIC
PHD 138 199 9.85e0 SMART
RING 139 198 2.12e-8 SMART
BBOX 226 273 1.24e-9 SMART
RING 231 293 2.01e0 SMART
BBOX 285 326 1.54e-10 SMART
BBC 333 459 7.55e-45 SMART
low complexity region 540 583 N/A INTRINSIC
low complexity region 731 773 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
PHD 902 945 4.15e-11 SMART
BROMO 972 1078 3.52e-35 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E9.5 with abnormal embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik TTCTGTA T 1: 43,737,192 probably benign Het
Adgrl1 T A 8: 83,934,772 S933T probably benign Het
Adgrl2 G A 3: 148,839,248 T737I probably damaging Het
Adra2c T A 5: 35,281,042 V386E probably damaging Het
Agbl5 C A 5: 30,903,245 T761N unknown Het
Ahnak T A 19: 9,013,601 M4083K possibly damaging Het
Aldh1l1 A T 6: 90,598,259 I843F probably damaging Het
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,909 probably benign Het
Arid1b GCG GCGCCG 17: 4,995,594 probably benign Het
B4galnt4 T C 7: 141,070,696 probably null Het
Blm C CTCCTCCTCCTAG 7: 80,512,933 probably null Het
Btg3 A G 16: 78,332,948 *52W probably null Het
Cc2d1a T C 8: 84,134,669 T796A probably damaging Het
Cd200r1 T C 16: 44,790,011 S161P possibly damaging Het
Cenpj A G 14: 56,530,048 probably null Het
Chd9 A G 8: 91,033,950 T2108A possibly damaging Het
Cherp TGGAGCG T 8: 72,462,059 probably benign Het
Cnot11 T C 1: 39,542,494 V372A probably damaging Het
Cntnap5b T C 1: 100,164,070 C179R probably damaging Het
Cntrl T A 2: 35,170,500 N1901K probably benign Het
Coil CTGG C 11: 88,981,830 probably benign Het
Col1a1 A G 11: 94,943,040 D488G probably damaging Het
Coro1a T C 7: 126,701,852 H130R probably damaging Het
Crybg3 A C 16: 59,556,704 S1396A possibly damaging Het
Csf2rb2 A G 15: 78,291,926 I259T probably benign Het
Cyp1a2 G T 9: 57,681,970 P187Q probably damaging Het
Cyp3a13 CATTATT CATT 5: 137,894,263 probably null Het
Dcun1d3 T C 7: 119,859,503 E103G possibly damaging Het
Dmkn T A 7: 30,769,704 probably null Het
Dna2 T C 10: 62,966,695 L864P probably damaging Het
Dnah14 T A 1: 181,685,809 M1909K probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Efna5 T C 17: 62,613,394 S163G probably benign Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Ercc4 C T 16: 13,123,507 S253L possibly damaging Het
Flywch1 ACCCA ACCCAATTCTGGTGTGGGGAGGCTACGTACTCTCCCA 17: 23,762,164 probably null Het
Flywch1 CCTGGTGT CCTGGTGTGGGGAGGCTACGTACTCACCCACTTCTGGTGT 17: 23,762,171 probably null Het
Folh1 T C 7: 86,775,687 T25A probably benign Het
Foxi3 C A 6: 70,960,861 T359K possibly damaging Het
Gab3 TCT TCTGCT X: 74,999,996 probably benign Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gab3 TTC TTCATC X: 75,000,025 probably benign Het
Gba2 G T 4: 43,569,894 L440M probably damaging Het
Gm14412 T A 2: 177,315,701 N134Y possibly damaging Het
Gpr88 A G 3: 116,252,369 S98P probably benign Het
Il1r1 A G 1: 40,313,278 Y539C probably damaging Het
Iqcf4 TTTCCTTTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTCTTCCTTTTCCTTTT 9: 106,570,609 probably benign Het
Lce1m CTGCT CTGCTTCCACTGTTGCT 3: 93,018,144 probably benign Het
Lkaaear1 T TATCTCCAGCTCC 2: 181,697,559 probably benign Het
Lkaaear1 CAGCTCCAGCTCCAGCTCCAGCTC CAGCTCCAGCTCTAGCTCCAGCTCCAGCTCCAGCTC 2: 181,697,577 probably benign Het
Ltb4r1 T A 14: 55,767,969 L243Q possibly damaging Het
Man2a1 T A 17: 64,712,253 V704D probably damaging Het
Map1a CTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGTTCCAGCTCCA 2: 121,306,308 probably benign Het
Mcu G T 10: 59,491,116 A63E probably benign Het
Mrps31 A T 8: 22,419,864 D182V possibly damaging Het
Mslnl T A 17: 25,743,228 V200E possibly damaging Het
Naip1 A T 13: 100,426,134 M841K probably benign Het
Ndufab1 T C 7: 122,096,638 K88E possibly damaging Het
Nlrp5 A C 7: 23,418,161 I437L probably benign Het
Nnt C T 13: 119,396,857 V91M probably damaging Het
Nusap1 TACACGTTAGCAGTGAGGAGCAAGCTGAGA TACACGTTAGCAGTGAGGAGCAAGCTGAGAGACACGTTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,581 probably benign Het
Nynrin T G 14: 55,866,201 probably null Het
Olfr358 T G 2: 37,005,174 T147P probably damaging Het
Olfr773 T A 10: 129,186,693 I243F probably damaging Het
Olfr992 C A 2: 85,399,793 A247S probably damaging Het
Osbpl8 A G 10: 111,276,467 K481R possibly damaging Het
Padi6 T C 4: 140,729,743 D540G probably damaging Het
Pcmtd1 T C 1: 7,155,105 probably benign Het
Pdik1l TTTTTGTTTT TTTTTGTTTTGGTTTTGTTTT 4: 134,279,368 probably null Het
Phospho1 T C 11: 95,831,055 Y184H probably damaging Het
Pi4ka T A 16: 17,297,233 R1431W Het
Plxdc1 T A 11: 97,978,678 H28L probably benign Het
Pnmal1 ACCTCATGATGCACCTGCTTCAACA ACCTCATGATGCACCTGCTTCAACACCTCATGATGCACCTGCTTCAACA 7: 16,961,424 probably benign Het
Ppp1r7 T C 1: 93,346,289 probably null Het
Ppp1r9a T A 6: 4,906,657 V404E probably damaging Het
Scfd1 T A 12: 51,422,973 S434T probably benign Het
Six5 A G 7: 19,094,937 S101G probably benign Het
Slc6a4 C A 11: 77,019,182 T421K probably damaging Het
Smarcd3 C A 5: 24,596,070 R113L probably damaging Het
Son T A 16: 91,659,369 M1668K possibly damaging Het
Tcf25 A G 8: 123,395,630 D434G probably benign Het
Tcof1 CCAGAGATCCCC CCAGAGATCCCCGTGGCTGCCGAGATGGGCACTTTCACAGAGATCCCC 18: 60,833,568 probably benign Het
Tep1 A G 14: 50,860,945 V463A possibly damaging Het
Thegl CTCCCCAGTCCCGCAAGGCCAG CTCCCCAGTCCCGCAAGGCCAGCGATCGTCCCCAGTCCCGCAAGGCCAG 5: 77,016,408 probably benign Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 AAG AAGCAG 14: 53,649,755 probably benign Het
Trim24 A G 6: 37,953,536 K642E possibly damaging Het
Triobp CTCCCTGTGCCCAACGG CTCCCTGTGCCCAACGGAACAACCCCAGGATTCCCTGTGCCCAACGG 15: 78,967,044 probably benign Het
Trmu G T 15: 85,892,569 V161L possibly damaging Het
Try4 T A 6: 41,305,363 C206S probably damaging Het
Usp2 TTCACTTAC TTCACTTACTCATGTGACCTGTTCGTCACTTAC 9: 44,089,121 probably benign Het
Vmn1r62 A T 7: 5,675,670 M117L probably benign Het
Vmn2r104 A T 17: 20,048,040 Y56N probably benign Het
Wdr66 G GGAT 5: 123,254,254 probably benign Het
Xxylt1 C T 16: 31,050,680 D201N possibly damaging Het
Zfp563 T A 17: 33,105,025 I198K probably benign Het
Zfp612 T A 8: 110,089,542 C460* probably null Het
Zfp691 G A 4: 119,170,735 T100M probably benign Het
Zfp773 A T 7: 7,132,690 C302* probably null Het
Zmat2 A G 18: 36,797,883 E154G probably damaging Het
Zw10 T A 9: 49,060,920 I132N possibly damaging Het
Other mutations in Trim33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Trim33 APN 3 103330182 missense probably benign 0.44
IGL00981:Trim33 APN 3 103351995 splice site probably benign
IGL01010:Trim33 APN 3 103346715 nonsense probably null
IGL01025:Trim33 APN 3 103353918 utr 3 prime probably benign
IGL01082:Trim33 APN 3 103326859 missense possibly damaging 0.49
IGL02245:Trim33 APN 3 103346770 critical splice donor site probably null
IGL02291:Trim33 APN 3 103326865 missense probably damaging 1.00
IGL03248:Trim33 APN 3 103310973 unclassified probably benign
IGL03400:Trim33 APN 3 103329143 missense probably damaging 0.99
abilene UTSW 3 103321559 missense probably damaging 0.99
Bemoaned UTSW 3 103326793 missense possibly damaging 0.92
Excision UTSW 3 103344576 missense probably damaging 1.00
Peaked UTSW 3 103337532 critical splice donor site probably null
Pike UTSW 3 103310885 missense probably damaging 0.98
westworld UTSW 3 103326901 missense possibly damaging 0.46
R0143:Trim33 UTSW 3 103352101 missense probably benign 0.00
R0471:Trim33 UTSW 3 103326901 missense possibly damaging 0.46
R0513:Trim33 UTSW 3 103310384 missense probably damaging 1.00
R0573:Trim33 UTSW 3 103351990 splice site probably benign
R0586:Trim33 UTSW 3 103310344 missense probably damaging 0.99
R1103:Trim33 UTSW 3 103310885 missense probably damaging 0.98
R1157:Trim33 UTSW 3 103353830 missense probably damaging 1.00
R1328:Trim33 UTSW 3 103353597 missense possibly damaging 0.86
R1331:Trim33 UTSW 3 103310354 missense probably damaging 0.99
R1385:Trim33 UTSW 3 103310950 missense possibly damaging 0.46
R1397:Trim33 UTSW 3 103310434 unclassified probably benign
R1785:Trim33 UTSW 3 103329220 frame shift probably null
R1848:Trim33 UTSW 3 103324640 unclassified probably benign
R1903:Trim33 UTSW 3 103337444 missense probably damaging 1.00
R3404:Trim33 UTSW 3 103321559 missense probably damaging 0.99
R3878:Trim33 UTSW 3 103352005 missense probably damaging 1.00
R4156:Trim33 UTSW 3 103310314 missense possibly damaging 0.94
R4281:Trim33 UTSW 3 103329086 missense probably damaging 0.99
R4570:Trim33 UTSW 3 103330165 missense probably damaging 0.96
R4809:Trim33 UTSW 3 103329256 missense possibly damaging 0.91
R4904:Trim33 UTSW 3 103331647 missense possibly damaging 0.46
R5168:Trim33 UTSW 3 103341681 nonsense probably null
R5458:Trim33 UTSW 3 103330180 missense possibly damaging 0.64
R5910:Trim33 UTSW 3 103344576 missense probably damaging 1.00
R6195:Trim33 UTSW 3 103337532 critical splice donor site probably null
R6331:Trim33 UTSW 3 103341609 missense probably benign 0.00
R6636:Trim33 UTSW 3 103353719 missense probably damaging 1.00
R6642:Trim33 UTSW 3 103337514 missense probably damaging 0.99
R6783:Trim33 UTSW 3 103352087 missense probably damaging 1.00
R6856:Trim33 UTSW 3 103352049 missense probably damaging 0.97
R7220:Trim33 UTSW 3 103326793 missense possibly damaging 0.92
R7325:Trim33 UTSW 3 103321636 missense possibly damaging 0.93
R7374:Trim33 UTSW 3 103310323 missense probably damaging 0.98
R7430:Trim33 UTSW 3 103310903 missense possibly damaging 0.92
R7438:Trim33 UTSW 3 103346640 splice site probably benign
R7491:Trim33 UTSW 3 103326148 missense probably benign 0.28
R8001:Trim33 UTSW 3 103311515 critical splice donor site probably null
R8127:Trim33 UTSW 3 103331727 missense possibly damaging 0.66
R8326:Trim33 UTSW 3 103311454 nonsense probably null
R8334:Trim33 UTSW 3 103353829 missense probably benign 0.06
RF005:Trim33 UTSW 3 103280212 frame shift probably null
RF014:Trim33 UTSW 3 103329092 missense possibly damaging 0.94
RF061:Trim33 UTSW 3 103280217 small deletion probably benign
RF064:Trim33 UTSW 3 103280195 frame shift probably null
Z1176:Trim33 UTSW 3 103353727 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCGGCGGGTTCAAAGAG -3'
(R):5'- CACCTTGCTGGACGTCAC -3'

Sequencing Primer
(F):5'- GGTAGCGCGCCGGTAAC -3'
(R):5'- ATGGGCACGCTGAGCTG -3'
Posted On2019-12-04