Incidental Mutation 'RF007:Triobp'
ID 602934
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF007 (G1)
Quality Score 217.468
Status Not validated
Chromosome 15
Chromosomal Location 78831924-78890069 bp(+) (GRCm39)
Type of Mutation small insertion (10 aa in frame mutation)
DNA Base Change (assembly) CTCCCTGTGCCCAACGG to CTCCCTGTGCCCAACGGAACAACCCCAGGATTCCCTGTGCCCAACGG at 78851244 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228]
AlphaFold Q99KW3
Predicted Effect probably benign
Transcript: ENSMUST00000109689
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109690
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140228
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 T A 8: 84,661,401 (GRCm39) S933T probably benign Het
Adgrl2 G A 3: 148,544,884 (GRCm39) T737I probably damaging Het
Adra2c T A 5: 35,438,386 (GRCm39) V386E probably damaging Het
Agbl5 C A 5: 31,060,589 (GRCm39) T761N unknown Het
Ahnak T A 19: 8,990,965 (GRCm39) M4083K possibly damaging Het
Aldh1l1 A T 6: 90,575,241 (GRCm39) I843F probably damaging Het
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,693,962 (GRCm39) probably benign Het
Arid1b GCG GCGCCG 17: 5,045,869 (GRCm39) probably benign Het
B4galnt4 T C 7: 140,650,609 (GRCm39) probably null Het
Blm C CTCCTCCTCCTAG 7: 80,162,681 (GRCm39) probably null Het
Btg3 A G 16: 78,129,836 (GRCm39) *52W probably null Het
Cc2d1a T C 8: 84,861,298 (GRCm39) T796A probably damaging Het
Cd200r1 T C 16: 44,610,374 (GRCm39) S161P possibly damaging Het
Cenpj A G 14: 56,767,505 (GRCm39) probably null Het
Cfap251 G GGAT 5: 123,392,317 (GRCm39) probably benign Het
Chd9 A G 8: 91,760,578 (GRCm39) T2108A possibly damaging Het
Cherp TGGAGCG T 8: 73,215,903 (GRCm39) probably benign Het
Cnot11 T C 1: 39,581,575 (GRCm39) V372A probably damaging Het
Cntnap5b T C 1: 100,091,795 (GRCm39) C179R probably damaging Het
Cntrl T A 2: 35,060,512 (GRCm39) N1901K probably benign Het
Coil CTGG C 11: 88,872,656 (GRCm39) probably benign Het
Col1a1 A G 11: 94,833,866 (GRCm39) D488G probably damaging Het
Coro1a T C 7: 126,301,024 (GRCm39) H130R probably damaging Het
Crybg3 A C 16: 59,377,067 (GRCm39) S1396A possibly damaging Het
Csf2rb2 A G 15: 78,176,126 (GRCm39) I259T probably benign Het
Cyp1a2 G T 9: 57,589,253 (GRCm39) P187Q probably damaging Het
Cyp3a13 CATTATT CATT 5: 137,892,525 (GRCm39) probably null Het
Dcun1d3 T C 7: 119,458,726 (GRCm39) E103G possibly damaging Het
Dmkn T A 7: 30,469,129 (GRCm39) probably null Het
Dna2 T C 10: 62,802,474 (GRCm39) L864P probably damaging Het
Dnah14 T A 1: 181,513,374 (GRCm39) M1909K probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,326,227 (GRCm39) probably benign Het
Ecrg4 TTCTGTA T 1: 43,776,352 (GRCm39) probably benign Het
Efna5 T C 17: 62,920,389 (GRCm39) S163G probably benign Het
Entpd2 CTT CTTT 2: 25,290,907 (GRCm39) probably null Het
Ercc4 C T 16: 12,941,371 (GRCm39) S253L possibly damaging Het
Flywch1 ACCCA ACCCAATTCTGGTGTGGGGAGGCTACGTACTCTCCCA 17: 23,981,138 (GRCm39) probably null Het
Flywch1 CCTGGTGT CCTGGTGTGGGGAGGCTACGTACTCACCCACTTCTGGTGT 17: 23,981,145 (GRCm39) probably null Het
Folh1 T C 7: 86,424,895 (GRCm39) T25A probably benign Het
Foxi3 C A 6: 70,937,845 (GRCm39) T359K possibly damaging Het
Gab3 TTC TTCATC X: 74,043,631 (GRCm39) probably benign Het
Gab3 TCT TCTGCT X: 74,043,602 (GRCm39) probably benign Het
Gab3 TCT TCTGCT X: 74,043,617 (GRCm39) probably benign Het
Gba2 G T 4: 43,569,894 (GRCm39) L440M probably damaging Het
Gm14412 T A 2: 177,007,494 (GRCm39) N134Y possibly damaging Het
Gpr88 A G 3: 116,046,018 (GRCm39) S98P probably benign Het
Il1r1 A G 1: 40,352,438 (GRCm39) Y539C probably damaging Het
Iqcf4 TTTCCTTTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTCTTCCTTTTCCTTTT 9: 106,447,808 (GRCm39) probably benign Het
Lce1m CTGCT CTGCTTCCACTGTTGCT 3: 92,925,451 (GRCm39) probably benign Het
Lkaaear1 T TATCTCCAGCTCC 2: 181,339,352 (GRCm39) probably benign Het
Lkaaear1 CAGCTCCAGCTCCAGCTCCAGCTC CAGCTCCAGCTCTAGCTCCAGCTCCAGCTCCAGCTC 2: 181,339,370 (GRCm39) probably benign Het
Ltb4r1 T A 14: 56,005,426 (GRCm39) L243Q possibly damaging Het
Man2a1 T A 17: 65,019,248 (GRCm39) V704D probably damaging Het
Map1a CTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGTTCCAGCTCCA 2: 121,136,789 (GRCm39) probably benign Het
Mcu G T 10: 59,326,938 (GRCm39) A63E probably benign Het
Mrps31 A T 8: 22,909,880 (GRCm39) D182V possibly damaging Het
Mslnl T A 17: 25,962,202 (GRCm39) V200E possibly damaging Het
Naip1 A T 13: 100,562,642 (GRCm39) M841K probably benign Het
Ndufab1 T C 7: 121,695,861 (GRCm39) K88E possibly damaging Het
Nlrp5 A C 7: 23,117,586 (GRCm39) I437L probably benign Het
Nnt C T 13: 119,533,393 (GRCm39) V91M probably damaging Het
Nusap1 TACACGTTAGCAGTGAGGAGCAAGCTGAGA TACACGTTAGCAGTGAGGAGCAAGCTGAGAGACACGTTAGCAGTGAGGAGCAAGCTGAGA 2: 119,458,062 (GRCm39) probably benign Het
Nynrin T G 14: 56,103,658 (GRCm39) probably null Het
Or12k5 T G 2: 36,895,186 (GRCm39) T147P probably damaging Het
Or5ak22 C A 2: 85,230,137 (GRCm39) A247S probably damaging Het
Or6c204 T A 10: 129,022,562 (GRCm39) I243F probably damaging Het
Osbpl8 A G 10: 111,112,328 (GRCm39) K481R possibly damaging Het
Padi6 T C 4: 140,457,054 (GRCm39) D540G probably damaging Het
Pcmtd1 T C 1: 7,225,329 (GRCm39) probably benign Het
Pdik1l TTTTTGTTTT TTTTTGTTTTGGTTTTGTTTT 4: 134,006,679 (GRCm39) probably null Het
Phospho1 T C 11: 95,721,881 (GRCm39) Y184H probably damaging Het
Pi4ka T A 16: 17,115,097 (GRCm39) R1431W Het
Plxdc1 T A 11: 97,869,504 (GRCm39) H28L probably benign Het
Pnma8a ACCTCATGATGCACCTGCTTCAACA ACCTCATGATGCACCTGCTTCAACACCTCATGATGCACCTGCTTCAACA 7: 16,695,349 (GRCm39) probably benign Het
Ppp1r7 T C 1: 93,274,011 (GRCm39) probably null Het
Ppp1r9a T A 6: 4,906,657 (GRCm39) V404E probably damaging Het
Scfd1 T A 12: 51,469,756 (GRCm39) S434T probably benign Het
Six5 A G 7: 18,828,862 (GRCm39) S101G probably benign Het
Slc6a4 C A 11: 76,910,008 (GRCm39) T421K probably damaging Het
Smarcd3 C A 5: 24,801,068 (GRCm39) R113L probably damaging Het
Son T A 16: 91,456,257 (GRCm39) M1668K possibly damaging Het
Spmap2l CTCCCCAGTCCCGCAAGGCCAG CTCCCCAGTCCCGCAAGGCCAGCGATCGTCCCCAGTCCCGCAAGGCCAG 5: 77,164,255 (GRCm39) probably benign Het
Tcf25 A G 8: 124,122,369 (GRCm39) D434G probably benign Het
Tcof1 CCAGAGATCCCC CCAGAGATCCCCGTGGCTGCCGAGATGGGCACTTTCACAGAGATCCCC 18: 60,966,640 (GRCm39) probably benign Het
Tep1 A G 14: 51,098,402 (GRCm39) V463A possibly damaging Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,887,207 (GRCm39) probably benign Het
Trav15-2-dv6-2 AAG AAGCAG 14: 53,887,212 (GRCm39) probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,887,208 (GRCm39) probably benign Het
Trim24 A G 6: 37,930,471 (GRCm39) K642E possibly damaging Het
Trim33 GGCCCCCGC GGC 3: 103,187,533 (GRCm39) probably benign Het
Trmu G T 15: 85,776,770 (GRCm39) V161L possibly damaging Het
Try4 T A 6: 41,282,297 (GRCm39) C206S probably damaging Het
Usp2 TTCACTTAC TTCACTTACTCATGTGACCTGTTCGTCACTTAC 9: 44,000,418 (GRCm39) probably benign Het
Vmn1r62 A T 7: 5,678,669 (GRCm39) M117L probably benign Het
Vmn2r104 A T 17: 20,268,302 (GRCm39) Y56N probably benign Het
Xxylt1 C T 16: 30,869,498 (GRCm39) D201N possibly damaging Het
Zfp563 T A 17: 33,323,999 (GRCm39) I198K probably benign Het
Zfp612 T A 8: 110,816,174 (GRCm39) C460* probably null Het
Zfp691 G A 4: 119,027,932 (GRCm39) T100M probably benign Het
Zfp773 A T 7: 7,135,689 (GRCm39) C302* probably null Het
Zmat2 A G 18: 36,930,936 (GRCm39) E154G probably damaging Het
Zw10 T A 9: 48,972,220 (GRCm39) I132N possibly damaging Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78,877,568 (GRCm39) missense probably damaging 1.00
IGL01904:Triobp APN 15 78,851,564 (GRCm39) missense possibly damaging 0.80
IGL01957:Triobp APN 15 78,856,847 (GRCm39) critical splice donor site probably null
IGL02085:Triobp APN 15 78,858,497 (GRCm39) splice site probably benign
IGL02260:Triobp APN 15 78,850,562 (GRCm39) missense probably benign 0.00
IGL02498:Triobp APN 15 78,845,243 (GRCm39) missense probably benign 0.01
IGL02551:Triobp APN 15 78,857,689 (GRCm39) missense probably benign
IGL02740:Triobp APN 15 78,850,889 (GRCm39) missense probably benign 0.21
IGL02810:Triobp APN 15 78,886,403 (GRCm39) missense possibly damaging 0.95
IGL03063:Triobp APN 15 78,875,084 (GRCm39) missense probably damaging 1.00
FR4304:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
FR4340:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4342:Triobp UTSW 15 78,877,592 (GRCm39) unclassified probably benign
FR4449:Triobp UTSW 15 78,877,589 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
R0276:Triobp UTSW 15 78,857,876 (GRCm39) missense probably benign 0.09
R0309:Triobp UTSW 15 78,860,740 (GRCm39) missense probably damaging 1.00
R0433:Triobp UTSW 15 78,852,401 (GRCm39) missense possibly damaging 0.69
R0464:Triobp UTSW 15 78,851,186 (GRCm39) missense possibly damaging 0.71
R0525:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0665:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0689:Triobp UTSW 15 78,844,188 (GRCm39) nonsense probably null
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1151:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1152:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1510:Triobp UTSW 15 78,887,967 (GRCm39) missense probably damaging 1.00
R1519:Triobp UTSW 15 78,857,938 (GRCm39) missense probably benign 0.00
R1642:Triobp UTSW 15 78,886,348 (GRCm39) missense probably damaging 1.00
R1732:Triobp UTSW 15 78,851,428 (GRCm39) missense possibly damaging 0.69
R1755:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1975:Triobp UTSW 15 78,850,908 (GRCm39) missense probably benign
R2051:Triobp UTSW 15 78,888,740 (GRCm39) missense probably damaging 1.00
R2073:Triobp UTSW 15 78,858,095 (GRCm39) missense probably damaging 0.99
R2260:Triobp UTSW 15 78,875,640 (GRCm39) critical splice donor site probably null
R2351:Triobp UTSW 15 78,888,780 (GRCm39) missense probably benign 0.09
R2902:Triobp UTSW 15 78,857,618 (GRCm39) missense possibly damaging 0.90
R3801:Triobp UTSW 15 78,857,900 (GRCm39) missense probably benign 0.04
R3959:Triobp UTSW 15 78,886,589 (GRCm39) nonsense probably null
R4003:Triobp UTSW 15 78,844,177 (GRCm39) unclassified probably benign
R4084:Triobp UTSW 15 78,857,871 (GRCm39) missense probably benign 0.19
R4482:Triobp UTSW 15 78,850,763 (GRCm39) missense possibly damaging 0.87
R4592:Triobp UTSW 15 78,851,295 (GRCm39) missense probably benign
R4662:Triobp UTSW 15 78,877,469 (GRCm39) missense probably damaging 1.00
R4732:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4733:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4789:Triobp UTSW 15 78,875,228 (GRCm39) missense probably damaging 1.00
R4968:Triobp UTSW 15 78,850,816 (GRCm39) missense probably benign 0.03
R4990:Triobp UTSW 15 78,851,205 (GRCm39) missense probably benign 0.00
R5129:Triobp UTSW 15 78,845,296 (GRCm39) missense probably benign 0.15
R5181:Triobp UTSW 15 78,851,954 (GRCm39) missense probably benign 0.00
R5279:Triobp UTSW 15 78,878,591 (GRCm39) missense possibly damaging 0.66
R5584:Triobp UTSW 15 78,852,332 (GRCm39) missense possibly damaging 0.89
R5601:Triobp UTSW 15 78,857,833 (GRCm39) missense probably damaging 1.00
R5810:Triobp UTSW 15 78,852,467 (GRCm39) missense probably benign 0.07
R5969:Triobp UTSW 15 78,851,740 (GRCm39) missense probably benign 0.05
R6722:Triobp UTSW 15 78,885,765 (GRCm39) missense probably damaging 1.00
R6739:Triobp UTSW 15 78,850,566 (GRCm39) missense possibly damaging 0.77
R6810:Triobp UTSW 15 78,850,815 (GRCm39) missense possibly damaging 0.47
R7011:Triobp UTSW 15 78,862,923 (GRCm39) missense probably damaging 0.98
R7015:Triobp UTSW 15 78,878,260 (GRCm39) missense probably damaging 0.99
R7200:Triobp UTSW 15 78,851,042 (GRCm39) small deletion probably benign
R7294:Triobp UTSW 15 78,858,176 (GRCm39) missense probably damaging 0.99
R7688:Triobp UTSW 15 78,845,311 (GRCm39) splice site probably null
R7805:Triobp UTSW 15 78,858,204 (GRCm39) missense probably benign 0.37
R7972:Triobp UTSW 15 78,852,186 (GRCm39) missense probably damaging 1.00
R7977:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7987:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7999:Triobp UTSW 15 78,844,144 (GRCm39) missense probably damaging 0.99
R8344:Triobp UTSW 15 78,842,475 (GRCm39) missense possibly damaging 0.67
R8348:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8446:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8448:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8469:Triobp UTSW 15 78,851,219 (GRCm39) missense probably benign 0.00
R8491:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8492:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8493:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R9424:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9495:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9514:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9530:Triobp UTSW 15 78,886,321 (GRCm39) missense probably damaging 1.00
R9550:Triobp UTSW 15 78,858,077 (GRCm39) missense probably damaging 1.00
R9576:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9646:Triobp UTSW 15 78,887,934 (GRCm39) missense probably damaging 1.00
RF001:Triobp UTSW 15 78,851,227 (GRCm39) small insertion probably benign
RF005:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF022:Triobp UTSW 15 78,858,482 (GRCm39) missense probably benign 0.05
RF028:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF032:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF035:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF040:Triobp UTSW 15 78,851,263 (GRCm39) small insertion probably benign
RF049:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF051:Triobp UTSW 15 78,851,234 (GRCm39) small insertion probably benign
RF058:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
X0026:Triobp UTSW 15 78,844,223 (GRCm39) missense possibly damaging 0.94
Z1177:Triobp UTSW 15 78,886,381 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCTAGGACTCCCTGTAC -3'
(R):5'- CTCCCATTTGCTGCAGGAAG -3'

Sequencing Primer
(F):5'- TAGGACTCCCTGTACCCAGAG -3'
(R):5'- CTGCAGGAAGCTGTAGTCTTATC -3'
Posted On 2019-12-04