Incidental Mutation 'RF007:Ercc4'
ID602936
Institutional Source Beutler Lab
Gene Symbol Ercc4
Ensembl Gene ENSMUSG00000022545
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 4
SynonymsXpf
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock #RF007 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location13109684-13150617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13123507 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 253 (S253L)
Ref Sequence ENSEMBL: ENSMUSP00000023206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023206] [ENSMUST00000129049] [ENSMUST00000141024]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023206
AA Change: S253L

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023206
Gene: ENSMUSG00000022545
AA Change: S253L

DomainStartEndE-ValueType
Blast:DEXDc 8 187 1e-5 BLAST
ERCC4 684 764 1.11e-26 SMART
low complexity region 789 802 N/A INTRINSIC
PDB:2AQ0|B 835 917 6e-37 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000129049
AA Change: S163L

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000141024
AA Change: S233L

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with ERCC1 and is involved in the 5' incision made during nucleotide excision repair. This complex is a structure specific DNA repair endonuclease that interacts with EME1. Defects in this gene are a cause of xeroderma pigmentosum complementation group F (XP-F), or xeroderma pigmentosum VI (XP6).[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice show impaired growth and do not survive longer than several weeks of age. Cultutred cells obtained from mutant mice were shown to be hypersensitive to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik TTCTGTA T 1: 43,737,192 probably benign Het
Adgrl1 T A 8: 83,934,772 S933T probably benign Het
Adgrl2 G A 3: 148,839,248 T737I probably damaging Het
Adra2c T A 5: 35,281,042 V386E probably damaging Het
Agbl5 C A 5: 30,903,245 T761N unknown Het
Ahnak T A 19: 9,013,601 M4083K possibly damaging Het
Aldh1l1 A T 6: 90,598,259 I843F probably damaging Het
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,909 probably benign Het
Arid1b GCG GCGCCG 17: 4,995,594 probably benign Het
B4galnt4 T C 7: 141,070,696 probably null Het
Blm C CTCCTCCTCCTAG 7: 80,512,933 probably null Het
Btg3 A G 16: 78,332,948 *52W probably null Het
Cc2d1a T C 8: 84,134,669 T796A probably damaging Het
Cd200r1 T C 16: 44,790,011 S161P possibly damaging Het
Cenpj A G 14: 56,530,048 probably null Het
Chd9 A G 8: 91,033,950 T2108A possibly damaging Het
Cherp TGGAGCG T 8: 72,462,059 probably benign Het
Cnot11 T C 1: 39,542,494 V372A probably damaging Het
Cntnap5b T C 1: 100,164,070 C179R probably damaging Het
Cntrl T A 2: 35,170,500 N1901K probably benign Het
Coil CTGG C 11: 88,981,830 probably benign Het
Col1a1 A G 11: 94,943,040 D488G probably damaging Het
Coro1a T C 7: 126,701,852 H130R probably damaging Het
Crybg3 A C 16: 59,556,704 S1396A possibly damaging Het
Csf2rb2 A G 15: 78,291,926 I259T probably benign Het
Cyp1a2 G T 9: 57,681,970 P187Q probably damaging Het
Cyp3a13 CATTATT CATT 5: 137,894,263 probably null Het
Dcun1d3 T C 7: 119,859,503 E103G possibly damaging Het
Dmkn T A 7: 30,769,704 probably null Het
Dna2 T C 10: 62,966,695 L864P probably damaging Het
Dnah14 T A 1: 181,685,809 M1909K probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Efna5 T C 17: 62,613,394 S163G probably benign Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Flywch1 ACCCA ACCCAATTCTGGTGTGGGGAGGCTACGTACTCTCCCA 17: 23,762,164 probably null Het
Flywch1 CCTGGTGT CCTGGTGTGGGGAGGCTACGTACTCACCCACTTCTGGTGT 17: 23,762,171 probably null Het
Folh1 T C 7: 86,775,687 T25A probably benign Het
Foxi3 C A 6: 70,960,861 T359K possibly damaging Het
Gab3 TCT TCTGCT X: 74,999,996 probably benign Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gab3 TTC TTCATC X: 75,000,025 probably benign Het
Gba2 G T 4: 43,569,894 L440M probably damaging Het
Gm14412 T A 2: 177,315,701 N134Y possibly damaging Het
Gpr88 A G 3: 116,252,369 S98P probably benign Het
Il1r1 A G 1: 40,313,278 Y539C probably damaging Het
Iqcf4 TTTCCTTTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTCTTCCTTTTCCTTTT 9: 106,570,609 probably benign Het
Lce1m CTGCT CTGCTTCCACTGTTGCT 3: 93,018,144 probably benign Het
Lkaaear1 T TATCTCCAGCTCC 2: 181,697,559 probably benign Het
Lkaaear1 CAGCTCCAGCTCCAGCTCCAGCTC CAGCTCCAGCTCTAGCTCCAGCTCCAGCTCCAGCTC 2: 181,697,577 probably benign Het
Ltb4r1 T A 14: 55,767,969 L243Q possibly damaging Het
Man2a1 T A 17: 64,712,253 V704D probably damaging Het
Map1a CTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGTTCCAGCTCCA 2: 121,306,308 probably benign Het
Mcu G T 10: 59,491,116 A63E probably benign Het
Mrps31 A T 8: 22,419,864 D182V possibly damaging Het
Mslnl T A 17: 25,743,228 V200E possibly damaging Het
Naip1 A T 13: 100,426,134 M841K probably benign Het
Ndufab1 T C 7: 122,096,638 K88E possibly damaging Het
Nlrp5 A C 7: 23,418,161 I437L probably benign Het
Nnt C T 13: 119,396,857 V91M probably damaging Het
Nusap1 TACACGTTAGCAGTGAGGAGCAAGCTGAGA TACACGTTAGCAGTGAGGAGCAAGCTGAGAGACACGTTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,581 probably benign Het
Nynrin T G 14: 55,866,201 probably null Het
Olfr358 T G 2: 37,005,174 T147P probably damaging Het
Olfr773 T A 10: 129,186,693 I243F probably damaging Het
Olfr992 C A 2: 85,399,793 A247S probably damaging Het
Osbpl8 A G 10: 111,276,467 K481R possibly damaging Het
Padi6 T C 4: 140,729,743 D540G probably damaging Het
Pcmtd1 T C 1: 7,155,105 probably benign Het
Pdik1l TTTTTGTTTT TTTTTGTTTTGGTTTTGTTTT 4: 134,279,368 probably null Het
Phospho1 T C 11: 95,831,055 Y184H probably damaging Het
Pi4ka T A 16: 17,297,233 R1431W Het
Plxdc1 T A 11: 97,978,678 H28L probably benign Het
Pnmal1 ACCTCATGATGCACCTGCTTCAACA ACCTCATGATGCACCTGCTTCAACACCTCATGATGCACCTGCTTCAACA 7: 16,961,424 probably benign Het
Ppp1r7 T C 1: 93,346,289 probably null Het
Ppp1r9a T A 6: 4,906,657 V404E probably damaging Het
Scfd1 T A 12: 51,422,973 S434T probably benign Het
Six5 A G 7: 19,094,937 S101G probably benign Het
Slc6a4 C A 11: 77,019,182 T421K probably damaging Het
Smarcd3 C A 5: 24,596,070 R113L probably damaging Het
Son T A 16: 91,659,369 M1668K possibly damaging Het
Tcf25 A G 8: 123,395,630 D434G probably benign Het
Tcof1 CCAGAGATCCCC CCAGAGATCCCCGTGGCTGCCGAGATGGGCACTTTCACAGAGATCCCC 18: 60,833,568 probably benign Het
Tep1 A G 14: 50,860,945 V463A possibly damaging Het
Thegl CTCCCCAGTCCCGCAAGGCCAG CTCCCCAGTCCCGCAAGGCCAGCGATCGTCCCCAGTCCCGCAAGGCCAG 5: 77,016,408 probably benign Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 AAG AAGCAG 14: 53,649,755 probably benign Het
Trim24 A G 6: 37,953,536 K642E possibly damaging Het
Trim33 GGCCCCCGC GGC 3: 103,280,217 probably benign Het
Triobp CTCCCTGTGCCCAACGG CTCCCTGTGCCCAACGGAACAACCCCAGGATTCCCTGTGCCCAACGG 15: 78,967,044 probably benign Het
Trmu G T 15: 85,892,569 V161L possibly damaging Het
Try4 T A 6: 41,305,363 C206S probably damaging Het
Usp2 TTCACTTAC TTCACTTACTCATGTGACCTGTTCGTCACTTAC 9: 44,089,121 probably benign Het
Vmn1r62 A T 7: 5,675,670 M117L probably benign Het
Vmn2r104 A T 17: 20,048,040 Y56N probably benign Het
Wdr66 G GGAT 5: 123,254,254 probably benign Het
Xxylt1 C T 16: 31,050,680 D201N possibly damaging Het
Zfp563 T A 17: 33,105,025 I198K probably benign Het
Zfp612 T A 8: 110,089,542 C460* probably null Het
Zfp691 G A 4: 119,170,735 T100M probably benign Het
Zfp773 A T 7: 7,132,690 C302* probably null Het
Zmat2 A G 18: 36,797,883 E154G probably damaging Het
Zw10 T A 9: 49,060,920 I132N possibly damaging Het
Other mutations in Ercc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Ercc4 APN 16 13125369 missense possibly damaging 0.91
IGL00805:Ercc4 APN 16 13122004 missense possibly damaging 0.77
IGL01348:Ercc4 APN 16 13132934 missense probably damaging 1.00
IGL02406:Ercc4 APN 16 13123536 missense probably damaging 1.00
IGL03248:Ercc4 APN 16 13127593 missense probably damaging 1.00
Rapscallion UTSW 16 13126467 missense probably benign
Rascal UTSW 16 13132947 missense probably damaging 1.00
PIT4812001:Ercc4 UTSW 16 13144447 missense probably benign 0.29
R0212:Ercc4 UTSW 16 13123332 critical splice acceptor site probably null
R0505:Ercc4 UTSW 16 13126467 missense probably benign
R0962:Ercc4 UTSW 16 13130146 missense probably damaging 0.99
R1078:Ercc4 UTSW 16 13130197 missense probably benign 0.00
R1356:Ercc4 UTSW 16 13125282 missense probably damaging 0.99
R1420:Ercc4 UTSW 16 13130209 missense probably benign 0.01
R1554:Ercc4 UTSW 16 13147622 missense probably damaging 1.00
R1899:Ercc4 UTSW 16 13147787 missense probably damaging 1.00
R2128:Ercc4 UTSW 16 13147934 missense probably damaging 0.99
R2214:Ercc4 UTSW 16 13110024 missense probably damaging 1.00
R3757:Ercc4 UTSW 16 13144496 missense probably benign 0.28
R4072:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4073:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4075:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4076:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4646:Ercc4 UTSW 16 13147574 missense probably damaging 1.00
R4731:Ercc4 UTSW 16 13147607 missense probably damaging 1.00
R4756:Ercc4 UTSW 16 13123423 missense probably damaging 1.00
R4767:Ercc4 UTSW 16 13122095 missense probably damaging 1.00
R5011:Ercc4 UTSW 16 13123581 intron probably benign
R5013:Ercc4 UTSW 16 13123581 intron probably benign
R5301:Ercc4 UTSW 16 13130686 missense probably damaging 1.00
R5308:Ercc4 UTSW 16 13130164 missense probably damaging 1.00
R5684:Ercc4 UTSW 16 13130601 missense probably benign 0.35
R6083:Ercc4 UTSW 16 13110039 nonsense probably null
R6092:Ercc4 UTSW 16 13125261 missense probably benign 0.04
R6815:Ercc4 UTSW 16 13123435 missense probably damaging 0.99
R6953:Ercc4 UTSW 16 13130686 missense probably damaging 1.00
R7062:Ercc4 UTSW 16 13132947 missense probably damaging 1.00
R7199:Ercc4 UTSW 16 13147793 missense probably damaging 1.00
R7317:Ercc4 UTSW 16 13122113 missense probably benign 0.12
R7858:Ercc4 UTSW 16 13125305 missense probably damaging 0.98
R7948:Ercc4 UTSW 16 13130185 missense probably benign 0.00
R8245:Ercc4 UTSW 16 13130137 missense probably benign 0.00
R8408:Ercc4 UTSW 16 13130137 missense probably benign 0.00
R8409:Ercc4 UTSW 16 13130137 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTGATTTGGAAACTGTCTCCGTAG -3'
(R):5'- CAAACACGTATGTCACTGCGAC -3'

Sequencing Primer
(F):5'- CGTAGGTTCCATGTAGCAGTCAAC -3'
(R):5'- TACTATTTCCCAGTGGGCAAAGC -3'
Posted On2019-12-04