Incidental Mutation 'RF007:Son'
ID602941
Institutional Source Beutler Lab
Gene Symbol Son
Ensembl Gene ENSMUSG00000022961
Gene NameSon DNA binding protein
Synonyms2900011L12Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #RF007 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location91647506-91679221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91659369 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1668 (M1668K)
Ref Sequence ENSEMBL: ENSMUSP00000109671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114036
AA Change: M1668K

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: M1668K

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.65e-7 PROSPERO
internal_repeat_2 214 362 6.55e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.65e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.55e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114037
AA Change: M1668K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: M1668K

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117633
AA Change: M1668K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: M1668K

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119368
AA Change: M1668K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: M1668K

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.22e-7 PROSPERO
internal_repeat_2 214 362 8.67e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.22e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 8.67e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140312
AA Change: M1668K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: M1668K

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147891
SMART Domains Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
Pfam:RSRP 61 358 2.9e-13 PFAM
low complexity region 466 477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik TTCTGTA T 1: 43,737,192 probably benign Het
Adgrl1 T A 8: 83,934,772 S933T probably benign Het
Adgrl2 G A 3: 148,839,248 T737I probably damaging Het
Adra2c T A 5: 35,281,042 V386E probably damaging Het
Agbl5 C A 5: 30,903,245 T761N unknown Het
Ahnak T A 19: 9,013,601 M4083K possibly damaging Het
Aldh1l1 A T 6: 90,598,259 I843F probably damaging Het
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,909 probably benign Het
Arid1b GCG GCGCCG 17: 4,995,594 probably benign Het
B4galnt4 T C 7: 141,070,696 probably null Het
Blm C CTCCTCCTCCTAG 7: 80,512,933 probably null Het
Cc2d1a T C 8: 84,134,669 T796A probably damaging Het
Cd200r1 T C 16: 44,790,011 S161P possibly damaging Het
Cenpj A G 14: 56,530,048 probably null Het
Chd9 A G 8: 91,033,950 T2108A possibly damaging Het
Cherp TGGAGCG T 8: 72,462,059 probably benign Het
Cnot11 T C 1: 39,542,494 V372A probably damaging Het
Cntnap5b T C 1: 100,164,070 C179R probably damaging Het
Cntrl T A 2: 35,170,500 N1901K probably benign Het
Coil CTGG C 11: 88,981,830 probably benign Het
Col1a1 A G 11: 94,943,040 D488G probably damaging Het
Coro1a T C 7: 126,701,852 H130R probably damaging Het
Crybg3 A C 16: 59,556,704 S1396A possibly damaging Het
Csf2rb T C 15: 78,341,383 I258T probably benign Het
Csf2rb2 A G 15: 78,291,926 I259T probably benign Het
Cyp1a2 G T 9: 57,681,970 P187Q probably damaging Het
Cyp3a13 CATTATT CATT 5: 137,894,263 probably null Het
Dcun1d3 T C 7: 119,859,503 E103G possibly damaging Het
Dna2 T C 10: 62,966,695 L864P probably damaging Het
Dnah14 T A 1: 181,685,809 M1909K probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Efna5 T C 17: 62,613,394 S163G probably benign Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Ercc4 C T 16: 13,123,507 S253L possibly damaging Het
Flywch1 ACCCA ACCCAATTCTGGTGTGGGGAGGCTACGTACTCTCCCA 17: 23,762,164 probably null Het
Flywch1 CCTGGTGT CCTGGTGTGGGGAGGCTACGTACTCACCCACTTCTGGTGT 17: 23,762,171 probably null Het
Folh1 T C 7: 86,775,687 T25A probably benign Het
Foxi3 C A 6: 70,960,861 T359K possibly damaging Het
Gab3 TCT TCTGCT X: 74,999,996 probably benign Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gab3 TTC TTCATC X: 75,000,025 probably benign Het
Gba2 G T 4: 43,569,894 L440M probably damaging Het
Gpr88 A G 3: 116,252,369 S98P probably benign Het
Il1r1 A G 1: 40,313,278 Y539C probably damaging Het
Iqcf4 TTTCCTTTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTCTTCCTTTTCCTTTT 9: 106,570,609 probably benign Het
Lce1m CTGCT CTGCTTCCACTGTTGCT 3: 93,018,144 probably benign Het
Lkaaear1 T TATCTCCAGCTCC 2: 181,697,559 probably benign Het
Lkaaear1 CAGCTCCAGCTCCAGCTCCAGCTC CAGCTCCAGCTCTAGCTCCAGCTCCAGCTCCAGCTC 2: 181,697,577 probably benign Het
Ltb4r1 T A 14: 55,767,969 L243Q possibly damaging Het
Man2a1 T A 17: 64,712,253 V704D probably damaging Het
Map1a CTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGTTCCAGCTCCA 2: 121,306,308 probably benign Het
Mcu G T 10: 59,491,116 A63E probably benign Het
Mrps31 A T 8: 22,419,864 D182V possibly damaging Het
Mslnl T A 17: 25,743,228 V200E possibly damaging Het
Naip1 A T 13: 100,426,134 M841K probably benign Het
Ndufab1 T C 7: 122,096,638 K88E possibly damaging Het
Nlrp5 A C 7: 23,418,161 I437L probably benign Het
Nnt C T 13: 119,396,857 V91M probably damaging Het
Nusap1 TACACGTTAGCAGTGAGGAGCAAGCTGAGA TACACGTTAGCAGTGAGGAGCAAGCTGAGAGACACGTTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,581 probably benign Het
Olfr358 T G 2: 37,005,174 T147P probably damaging Het
Olfr773 T A 10: 129,186,693 I243F probably damaging Het
Olfr992 C A 2: 85,399,793 A247S probably damaging Het
Osbpl8 A G 10: 111,276,467 K481R possibly damaging Het
Padi6 T C 4: 140,729,743 D540G probably damaging Het
Pdik1l TTTTTGTTTT TTTTTGTTTTGGTTTTGTTTT 4: 134,279,368 probably null Het
Phospho1 T C 11: 95,831,055 Y184H probably damaging Het
Pi4ka T A 16: 17,297,233 R1431W Het
Plxdc1 T A 11: 97,978,678 H28L probably benign Het
Pnmal1 ACCTCATGATGCACCTGCTTCAACA ACCTCATGATGCACCTGCTTCAACACCTCATGATGCACCTGCTTCAACA 7: 16,961,424 probably benign Het
Ppp1r7 T C 1: 93,346,289 probably null Het
Ppp1r9a T A 6: 4,906,657 V404E probably damaging Het
Scfd1 T A 12: 51,422,973 S434T probably benign Het
Six5 A G 7: 19,094,937 S101G probably benign Het
Slc6a4 C A 11: 77,019,182 T421K probably damaging Het
Smarcd3 C A 5: 24,596,070 R113L probably damaging Het
Tcf25 A G 8: 123,395,630 D434G probably benign Het
Tcof1 CCAGAGATCCCC CCAGAGATCCCCGTGGCTGCCGAGATGGGCACTTTCACAGAGATCCCC 18: 60,833,568 probably benign Het
Tep1 A G 14: 50,860,945 V463A possibly damaging Het
Thegl CTCCCCAGTCCCGCAAGGCCAG CTCCCCAGTCCCGCAAGGCCAGCGATCGTCCCCAGTCCCGCAAGGCCAG 5: 77,016,408 probably benign Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 AAG AAGCAG 14: 53,649,755 probably benign Het
Trim24 A G 6: 37,953,536 K642E possibly damaging Het
Trim33 GGCCCCCGC GGC 3: 103,280,217 probably benign Het
Triobp CTCCCTGTGCCCAACGG CTCCCTGTGCCCAACGGAACAACCCCAGGATTCCCTGTGCCCAACGG 15: 78,967,044 probably benign Het
Trmu G T 15: 85,892,569 V161L possibly damaging Het
Try4 T A 6: 41,305,363 C206S probably damaging Het
Usp2 TTCACTTAC TTCACTTACTCATGTGACCTGTTCGTCACTTAC 9: 44,089,121 probably benign Het
Vmn1r62 A T 7: 5,675,670 M117L probably benign Het
Vmn2r104 A T 17: 20,048,040 Y56N probably benign Het
Wdr66 G GGAT 5: 123,254,254 probably benign Het
Xxylt1 C T 16: 31,050,680 D201N possibly damaging Het
Zfp563 T A 17: 33,105,025 I198K probably benign Het
Zfp612 T A 8: 110,089,542 C460* probably null Het
Zfp691 G A 4: 119,170,735 T100M probably benign Het
Zfp773 A T 7: 7,132,690 C302* probably null Het
Zmat2 A G 18: 36,797,883 E154G probably damaging Het
Zw10 T A 9: 49,060,920 I132N possibly damaging Het
Other mutations in Son
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Son APN 16 91664322 missense probably damaging 0.99
IGL01024:Son APN 16 91655910 missense probably damaging 1.00
IGL01066:Son APN 16 91660136 intron probably benign
IGL01083:Son APN 16 91657391 missense probably damaging 1.00
IGL01115:Son APN 16 91659458 missense probably benign 0.31
IGL01467:Son APN 16 91657277 missense possibly damaging 0.93
IGL01506:Son APN 16 91657286 missense possibly damaging 0.67
IGL01933:Son APN 16 91658015 missense probably benign 0.00
IGL02156:Son APN 16 91656104 missense possibly damaging 0.93
IGL02473:Son APN 16 91658795 missense probably damaging 0.99
IGL02498:Son APN 16 91656825 missense probably damaging 0.99
IGL02517:Son APN 16 91655211 missense possibly damaging 0.92
IGL02530:Son APN 16 91658471 missense possibly damaging 0.50
IGL02865:Son APN 16 91651752 missense probably damaging 1.00
IGL03180:Son APN 16 91657008 missense probably damaging 1.00
R0013:Son UTSW 16 91651662 missense probably damaging 1.00
R0036:Son UTSW 16 91660166 intron probably benign
R0037:Son UTSW 16 91664728 missense probably damaging 1.00
R0041:Son UTSW 16 91659333 missense probably damaging 1.00
R0048:Son UTSW 16 91658977 missense possibly damaging 0.94
R0048:Son UTSW 16 91658977 missense possibly damaging 0.94
R0056:Son UTSW 16 91678155 missense possibly damaging 0.86
R0227:Son UTSW 16 91656873 missense probably damaging 0.99
R0256:Son UTSW 16 91656584 missense possibly damaging 0.95
R0302:Son UTSW 16 91656144 missense probably damaging 1.00
R0815:Son UTSW 16 91655484 missense probably damaging 0.98
R1225:Son UTSW 16 91657340 missense probably damaging 1.00
R1255:Son UTSW 16 91664695 missense probably damaging 1.00
R1457:Son UTSW 16 91657086 missense probably damaging 1.00
R1459:Son UTSW 16 91655342 missense possibly damaging 0.93
R1535:Son UTSW 16 91659734 missense probably damaging 0.99
R1587:Son UTSW 16 91659718 missense probably damaging 1.00
R1605:Son UTSW 16 91657664 missense probably damaging 1.00
R1629:Son UTSW 16 91657622 missense probably damaging 1.00
R1711:Son UTSW 16 91660226 intron probably benign
R2138:Son UTSW 16 91659372 missense possibly damaging 0.95
R2245:Son UTSW 16 91647960 unclassified probably null
R2351:Son UTSW 16 91657659 missense probably damaging 0.98
R2434:Son UTSW 16 91654687 missense probably damaging 1.00
R2870:Son UTSW 16 91664317 unclassified probably null
R2871:Son UTSW 16 91664317 unclassified probably null
R2872:Son UTSW 16 91664317 unclassified probably null
R2889:Son UTSW 16 91659899 unclassified probably benign
R3712:Son UTSW 16 91656726 missense probably damaging 0.99
R3913:Son UTSW 16 91660111 intron probably benign
R4172:Son UTSW 16 91659362 missense probably damaging 1.00
R4301:Son UTSW 16 91658411 missense possibly damaging 0.53
R4302:Son UTSW 16 91658411 missense possibly damaging 0.53
R4770:Son UTSW 16 91658868 missense probably damaging 0.96
R4881:Son UTSW 16 91675509 missense probably benign 0.31
R5020:Son UTSW 16 91656375 missense probably damaging 1.00
R5032:Son UTSW 16 91657664 missense probably damaging 1.00
R5151:Son UTSW 16 91655699 missense probably damaging 1.00
R5153:Son UTSW 16 91655022 missense possibly damaging 0.86
R5215:Son UTSW 16 91656675 missense probably damaging 0.99
R5243:Son UTSW 16 91654733 missense probably damaging 1.00
R5354:Son UTSW 16 91655739 missense probably damaging 0.99
R5529:Son UTSW 16 91655466 missense probably damaging 1.00
R5696:Son UTSW 16 91671413 missense possibly damaging 0.67
R5763:Son UTSW 16 91657490 missense probably damaging 1.00
R5766:Son UTSW 16 91664987 intron probably benign
R5788:Son UTSW 16 91660052 intron probably benign
R5992:Son UTSW 16 91658904 missense probably benign 0.04
R6314:Son UTSW 16 91660410 intron probably benign
R6371:Son UTSW 16 91674741
R6429:Son UTSW 16 91658166 missense probably benign 0.33
R6451:Son UTSW 16 91657602 missense probably damaging 0.99
R6489:Son UTSW 16 91655156 missense possibly damaging 0.70
R6513:Son UTSW 16 91659947 intron probably benign
R6753:Son UTSW 16 91657188 missense probably damaging 0.99
R6916:Son UTSW 16 91654785 missense probably damaging 0.97
R7070:Son UTSW 16 91656841 unclassified probably benign
R7079:Son UTSW 16 91656841 unclassified probably benign
R7110:Son UTSW 16 91656518 missense probably benign 0.01
R7120:Son UTSW 16 91656691 unclassified probably benign
R7120:Son UTSW 16 91670526 missense unknown
R7167:Son UTSW 16 91660334 small deletion probably benign
R7205:Son UTSW 16 91660295 small deletion probably benign
R7208:Son UTSW 16 91662102 missense unknown
R7219:Son UTSW 16 91665001 missense unknown
R7249:Son UTSW 16 91660334 small deletion probably benign
R7328:Son UTSW 16 91658390 missense probably benign 0.33
R7330:Son UTSW 16 91656598 unclassified probably benign
R7374:Son UTSW 16 91660334 small deletion probably benign
R7405:Son UTSW 16 91656691 unclassified probably benign
R7420:Son UTSW 16 91660334 small deletion probably benign
R7424:Son UTSW 16 91660334 small deletion probably benign
R7464:Son UTSW 16 91656691 unclassified probably benign
R7514:Son UTSW 16 91654860 missense probably damaging 0.99
R7555:Son UTSW 16 91658922 missense probably damaging 0.99
R7645:Son UTSW 16 91660295 small deletion probably benign
R7716:Son UTSW 16 91656691 unclassified probably benign
R7718:Son UTSW 16 91660334 small deletion probably benign
R7778:Son UTSW 16 91656528 missense probably damaging 0.99
R7824:Son UTSW 16 91656528 missense probably damaging 0.99
R7856:Son UTSW 16 91659258 missense probably damaging 0.99
R7870:Son UTSW 16 91656598 unclassified probably benign
R7939:Son UTSW 16 91659258 missense probably damaging 0.99
R8000:Son UTSW 16 91660334 small deletion probably benign
RF021:Son UTSW 16 91656691 unclassified probably benign
RF041:Son UTSW 16 91656691 unclassified probably benign
Z1176:Son UTSW 16 91655801 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AATTGGCTACCTGTGCTGCC -3'
(R):5'- TGCTGGCAGAATATCCTGAC -3'

Sequencing Primer
(F):5'- TACCTGTGCTGCCGTCAG -3'
(R):5'- GACTCAGGAACTATTTCTTTATTGGG -3'
Posted On2019-12-04