Incidental Mutation 'RF007:Tcof1'
ID602952
Institutional Source Beutler Lab
Gene Symbol Tcof1
Ensembl Gene ENSMUSG00000024613
Gene Nametreacle ribosome biogenesis factor 1
Synonymstreacle
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF007 (G1)
Quality Score217.468
Status Not validated
Chromosome18
Chromosomal Location60813755-60848971 bp(-) (GRCm38)
Type of Mutationsmall insertion (12 aa in frame mutation)
DNA Base Change (assembly) CCAGAGATCCCC to CCAGAGATCCCCGTGGCTGCCGAGATGGGCACTTTCACAGAGATCCCC at 60833568 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172]
Predicted Effect probably benign
Transcript: ENSMUST00000163446
SMART Domains Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 322 2.2e-8 PFAM
Pfam:Treacle 321 793 4.6e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 855 874 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 916 927 N/A INTRINSIC
low complexity region 967 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175934
SMART Domains Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 153 329 1.6e-12 PFAM
Pfam:Treacle 321 792 6.1e-175 PFAM
Pfam:Treacle 782 936 3.2e-16 PFAM
low complexity region 969 982 N/A INTRINSIC
low complexity region 1025 1039 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1149 1172 N/A INTRINSIC
low complexity region 1260 1285 N/A INTRINSIC
coiled coil region 1306 1335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176630
SMART Domains Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 323 2.5e-8 PFAM
Pfam:Treacle 321 793 5.9e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 843 857 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 933 946 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
coiled coil region 1270 1299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177172
SMART Domains Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 150 322 1.3e-10 PFAM
Pfam:Treacle 321 506 1.5e-78 PFAM
Pfam:Treacle 498 745 2e-105 PFAM
low complexity region 771 786 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
low complexity region 941 955 N/A INTRINSIC
low complexity region 976 990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik TTCTGTA T 1: 43,737,192 probably benign Het
Adgrl1 T A 8: 83,934,772 S933T probably benign Het
Adgrl2 G A 3: 148,839,248 T737I probably damaging Het
Adra2c T A 5: 35,281,042 V386E probably damaging Het
Agbl5 C A 5: 30,903,245 T761N unknown Het
Ahnak T A 19: 9,013,601 M4083K possibly damaging Het
Aldh1l1 A T 6: 90,598,259 I843F probably damaging Het
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,909 probably benign Het
Arid1b GCG GCGCCG 17: 4,995,594 probably benign Het
B4galnt4 T C 7: 141,070,696 probably null Het
Blm C CTCCTCCTCCTAG 7: 80,512,933 probably null Het
Cc2d1a T C 8: 84,134,669 T796A probably damaging Het
Cd200r1 T C 16: 44,790,011 S161P possibly damaging Het
Cenpj A G 14: 56,530,048 probably null Het
Chd9 A G 8: 91,033,950 T2108A possibly damaging Het
Cherp TGGAGCG T 8: 72,462,059 probably benign Het
Cnot11 T C 1: 39,542,494 V372A probably damaging Het
Cntnap5b T C 1: 100,164,070 C179R probably damaging Het
Cntrl T A 2: 35,170,500 N1901K probably benign Het
Coil CTGG C 11: 88,981,830 probably benign Het
Col1a1 A G 11: 94,943,040 D488G probably damaging Het
Coro1a T C 7: 126,701,852 H130R probably damaging Het
Crybg3 A C 16: 59,556,704 S1396A possibly damaging Het
Csf2rb T C 15: 78,341,383 I258T probably benign Het
Csf2rb2 A G 15: 78,291,926 I259T probably benign Het
Cyp1a2 G T 9: 57,681,970 P187Q probably damaging Het
Cyp3a13 CATTATT CATT 5: 137,894,263 probably null Het
Dcun1d3 T C 7: 119,859,503 E103G possibly damaging Het
Dna2 T C 10: 62,966,695 L864P probably damaging Het
Dnah14 T A 1: 181,685,809 M1909K probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Efna5 T C 17: 62,613,394 S163G probably benign Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Ercc4 C T 16: 13,123,507 S253L possibly damaging Het
Flywch1 ACCCA ACCCAATTCTGGTGTGGGGAGGCTACGTACTCTCCCA 17: 23,762,164 probably null Het
Flywch1 CCTGGTGT CCTGGTGTGGGGAGGCTACGTACTCACCCACTTCTGGTGT 17: 23,762,171 probably null Het
Folh1 T C 7: 86,775,687 T25A probably benign Het
Foxi3 C A 6: 70,960,861 T359K possibly damaging Het
Gab3 TCT TCTGCT X: 74,999,996 probably benign Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gab3 TTC TTCATC X: 75,000,025 probably benign Het
Gba2 G T 4: 43,569,894 L440M probably damaging Het
Gpr88 A G 3: 116,252,369 S98P probably benign Het
Il1r1 A G 1: 40,313,278 Y539C probably damaging Het
Iqcf4 TTTCCTTTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTCTTCCTTTTCCTTTT 9: 106,570,609 probably benign Het
Lce1m CTGCT CTGCTTCCACTGTTGCT 3: 93,018,144 probably benign Het
Lkaaear1 T TATCTCCAGCTCC 2: 181,697,559 probably benign Het
Lkaaear1 CAGCTCCAGCTCCAGCTCCAGCTC CAGCTCCAGCTCTAGCTCCAGCTCCAGCTCCAGCTC 2: 181,697,577 probably benign Het
Ltb4r1 T A 14: 55,767,969 L243Q possibly damaging Het
Man2a1 T A 17: 64,712,253 V704D probably damaging Het
Map1a CTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGTTCCAGCTCCA 2: 121,306,308 probably benign Het
Mcu G T 10: 59,491,116 A63E probably benign Het
Mrps31 A T 8: 22,419,864 D182V possibly damaging Het
Mslnl T A 17: 25,743,228 V200E possibly damaging Het
Naip1 A T 13: 100,426,134 M841K probably benign Het
Ndufab1 T C 7: 122,096,638 K88E possibly damaging Het
Nlrp5 A C 7: 23,418,161 I437L probably benign Het
Nnt C T 13: 119,396,857 V91M probably damaging Het
Nusap1 TACACGTTAGCAGTGAGGAGCAAGCTGAGA TACACGTTAGCAGTGAGGAGCAAGCTGAGAGACACGTTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,581 probably benign Het
Olfr358 T G 2: 37,005,174 T147P probably damaging Het
Olfr773 T A 10: 129,186,693 I243F probably damaging Het
Olfr992 C A 2: 85,399,793 A247S probably damaging Het
Osbpl8 A G 10: 111,276,467 K481R possibly damaging Het
Padi6 T C 4: 140,729,743 D540G probably damaging Het
Pdik1l TTTTTGTTTT TTTTTGTTTTGGTTTTGTTTT 4: 134,279,368 probably null Het
Phospho1 T C 11: 95,831,055 Y184H probably damaging Het
Pi4ka T A 16: 17,297,233 R1431W Het
Plxdc1 T A 11: 97,978,678 H28L probably benign Het
Pnmal1 ACCTCATGATGCACCTGCTTCAACA ACCTCATGATGCACCTGCTTCAACACCTCATGATGCACCTGCTTCAACA 7: 16,961,424 probably benign Het
Ppp1r7 T C 1: 93,346,289 probably null Het
Ppp1r9a T A 6: 4,906,657 V404E probably damaging Het
Scfd1 T A 12: 51,422,973 S434T probably benign Het
Six5 A G 7: 19,094,937 S101G probably benign Het
Slc6a4 C A 11: 77,019,182 T421K probably damaging Het
Smarcd3 C A 5: 24,596,070 R113L probably damaging Het
Son T A 16: 91,659,369 M1668K possibly damaging Het
Tcf25 A G 8: 123,395,630 D434G probably benign Het
Tep1 A G 14: 50,860,945 V463A possibly damaging Het
Thegl CTCCCCAGTCCCGCAAGGCCAG CTCCCCAGTCCCGCAAGGCCAGCGATCGTCCCCAGTCCCGCAAGGCCAG 5: 77,016,408 probably benign Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 AAG AAGCAG 14: 53,649,755 probably benign Het
Trim24 A G 6: 37,953,536 K642E possibly damaging Het
Trim33 GGCCCCCGC GGC 3: 103,280,217 probably benign Het
Triobp CTCCCTGTGCCCAACGG CTCCCTGTGCCCAACGGAACAACCCCAGGATTCCCTGTGCCCAACGG 15: 78,967,044 probably benign Het
Trmu G T 15: 85,892,569 V161L possibly damaging Het
Try4 T A 6: 41,305,363 C206S probably damaging Het
Usp2 TTCACTTAC TTCACTTACTCATGTGACCTGTTCGTCACTTAC 9: 44,089,121 probably benign Het
Vmn1r62 A T 7: 5,675,670 M117L probably benign Het
Vmn2r104 A T 17: 20,048,040 Y56N probably benign Het
Wdr66 G GGAT 5: 123,254,254 probably benign Het
Xxylt1 C T 16: 31,050,680 D201N possibly damaging Het
Zfp563 T A 17: 33,105,025 I198K probably benign Het
Zfp612 T A 8: 110,089,542 C460* probably null Het
Zfp691 G A 4: 119,170,735 T100M probably benign Het
Zfp773 A T 7: 7,132,690 C302* probably null Het
Zmat2 A G 18: 36,797,883 E154G probably damaging Het
Zw10 T A 9: 49,060,920 I132N possibly damaging Het
Other mutations in Tcof1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tcof1 APN 18 60814568 unclassified probably benign
IGL01339:Tcof1 APN 18 60818095 utr 3 prime probably benign
IGL02072:Tcof1 APN 18 60831565 missense possibly damaging 0.85
IGL02160:Tcof1 APN 18 60848743 unclassified probably benign
IGL02513:Tcof1 APN 18 60831778 missense possibly damaging 0.51
IGL02823:Tcof1 APN 18 60816048 missense probably benign 0.00
IGL03161:Tcof1 APN 18 60833488 missense possibly damaging 0.86
IGL03291:Tcof1 APN 18 60829061 missense possibly damaging 0.71
FR4304:Tcof1 UTSW 18 60835742 unclassified probably benign
FR4589:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
FR4737:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
PIT4802001:Tcof1 UTSW 18 60831938 missense unknown
R0569:Tcof1 UTSW 18 60829035 missense possibly damaging 0.85
R0602:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R0744:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0782:Tcof1 UTSW 18 60816280 missense probably damaging 0.97
R0833:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0836:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0885:Tcof1 UTSW 18 60835850 missense possibly damaging 0.84
R1465:Tcof1 UTSW 18 60818954 splice site probably benign
R1528:Tcof1 UTSW 18 60814999 nonsense probably null
R1643:Tcof1 UTSW 18 60816228 missense possibly damaging 0.72
R1919:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R1920:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R1921:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R2023:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R2108:Tcof1 UTSW 18 60835773 missense probably damaging 0.97
R2114:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2115:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2116:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2117:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2156:Tcof1 UTSW 18 60831829 missense possibly damaging 0.92
R2221:Tcof1 UTSW 18 60837901 missense possibly damaging 0.51
R2229:Tcof1 UTSW 18 60832177 intron probably benign
R2913:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R2914:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R3944:Tcof1 UTSW 18 60822837 missense probably damaging 0.98
R3979:Tcof1 UTSW 18 60831533 missense possibly damaging 0.71
R4049:Tcof1 UTSW 18 60832903 missense possibly damaging 0.84
R4125:Tcof1 UTSW 18 60819601 missense unknown
R5047:Tcof1 UTSW 18 60831914 missense possibly damaging 0.86
R5433:Tcof1 UTSW 18 60818033 utr 3 prime probably benign
R5546:Tcof1 UTSW 18 60831556 missense possibly damaging 0.85
R5832:Tcof1 UTSW 18 60819539 missense unknown
R5965:Tcof1 UTSW 18 60833418 critical splice donor site probably null
R6301:Tcof1 UTSW 18 60828825 missense probably damaging 0.97
R6480:Tcof1 UTSW 18 60814780 intron probably null
R6910:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R6911:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7105:Tcof1 UTSW 18 60843296 missense probably damaging 1.00
R7225:Tcof1 UTSW 18 60828448 missense unknown
R7356:Tcof1 UTSW 18 60818094 missense unknown
R7467:Tcof1 UTSW 18 60831905 missense unknown
R7536:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7804:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7818:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7863:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7946:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8006:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8007:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8008:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8063:Tcof1 UTSW 18 60838762 missense probably damaging 1.00
RF001:Tcof1 UTSW 18 60835739 unclassified probably benign
RF005:Tcof1 UTSW 18 60833554 small insertion probably benign
RF009:Tcof1 UTSW 18 60835743 unclassified probably benign
RF010:Tcof1 UTSW 18 60835744 unclassified probably benign
RF011:Tcof1 UTSW 18 60835739 unclassified probably benign
RF013:Tcof1 UTSW 18 60835743 unclassified probably benign
RF015:Tcof1 UTSW 18 60833584 small insertion probably benign
RF016:Tcof1 UTSW 18 60833575 small insertion probably benign
RF022:Tcof1 UTSW 18 60835735 unclassified probably benign
RF024:Tcof1 UTSW 18 60835738 unclassified probably benign
RF027:Tcof1 UTSW 18 60835736 unclassified probably benign
RF029:Tcof1 UTSW 18 60835735 unclassified probably benign
RF029:Tcof1 UTSW 18 60835745 unclassified probably benign
RF030:Tcof1 UTSW 18 60833568 small insertion probably benign
RF030:Tcof1 UTSW 18 60833574 small insertion probably benign
RF030:Tcof1 UTSW 18 60835723 unclassified probably benign
RF031:Tcof1 UTSW 18 60833565 small insertion probably benign
RF031:Tcof1 UTSW 18 60835745 unclassified probably benign
RF035:Tcof1 UTSW 18 60833553 small insertion probably benign
RF036:Tcof1 UTSW 18 60828408 small insertion probably benign
RF036:Tcof1 UTSW 18 60835736 unclassified probably benign
RF038:Tcof1 UTSW 18 60833566 small insertion probably benign
RF040:Tcof1 UTSW 18 60828408 small insertion probably benign
RF040:Tcof1 UTSW 18 60833583 small insertion probably benign
RF041:Tcof1 UTSW 18 60833572 small insertion probably benign
RF041:Tcof1 UTSW 18 60833576 small insertion probably benign
RF043:Tcof1 UTSW 18 60833572 small insertion probably benign
RF050:Tcof1 UTSW 18 60833579 small insertion probably benign
RF051:Tcof1 UTSW 18 60833579 small insertion probably benign
RF053:Tcof1 UTSW 18 60835747 unclassified probably benign
RF056:Tcof1 UTSW 18 60833575 small insertion probably benign
RF057:Tcof1 UTSW 18 60833564 small insertion probably benign
RF057:Tcof1 UTSW 18 60833565 small insertion probably benign
RF057:Tcof1 UTSW 18 60833566 small insertion probably benign
RF057:Tcof1 UTSW 18 60833571 small insertion probably benign
RF060:Tcof1 UTSW 18 60835744 unclassified probably benign
RF060:Tcof1 UTSW 18 60835747 unclassified probably benign
RF063:Tcof1 UTSW 18 60833573 small insertion probably benign
RF064:Tcof1 UTSW 18 60833571 small insertion probably benign
RF064:Tcof1 UTSW 18 60833574 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TTAGCAGCCTTCAGGTCTGG -3'
(R):5'- ACTATATGGTGTCACTGGGTGC -3'

Sequencing Primer
(F):5'- CAGCCTTCAGGTCTGGGCTATAATG -3'
(R):5'- TGAGGAGGTCAGTGCTCAG -3'
Posted On2019-12-04