Incidental Mutation 'RF007:Ahnak'
ID602953
Institutional Source Beutler Lab
Gene Symbol Ahnak
Ensembl Gene ENSMUSG00000069833
Gene NameAHNAK nucleoprotein (desmoyokin)
Synonyms1110004P15Rik, 2310047C17Rik, DY6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #RF007 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8989284-9076919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9013601 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 4083 (M4083K)
Ref Sequence ENSEMBL: ENSMUSP00000090633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]
Predicted Effect probably benign
Transcript: ENSMUST00000092955
SMART Domains Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000092956
AA Change: M4083K

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: M4083K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
internal_repeat_2 163 1515 5.22e-182 PROSPERO
internal_repeat_1 224 2314 N/A PROSPERO
internal_repeat_2 1532 3028 5.22e-182 PROSPERO
internal_repeat_1 2660 5095 N/A PROSPERO
low complexity region 5336 5353 N/A INTRINSIC
low complexity region 5493 5504 N/A INTRINSIC
low complexity region 5580 5600 N/A INTRINSIC
low complexity region 5620 5636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik TTCTGTA T 1: 43,737,192 probably benign Het
Adgrl1 T A 8: 83,934,772 S933T probably benign Het
Adgrl2 G A 3: 148,839,248 T737I probably damaging Het
Adra2c T A 5: 35,281,042 V386E probably damaging Het
Agbl5 C A 5: 30,903,245 T761N unknown Het
Aldh1l1 A T 6: 90,598,259 I843F probably damaging Het
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,909 probably benign Het
Arid1b GCG GCGCCG 17: 4,995,594 probably benign Het
B4galnt4 T C 7: 141,070,696 probably null Het
Blm C CTCCTCCTCCTAG 7: 80,512,933 probably null Het
Btg3 A G 16: 78,332,948 *52W probably null Het
Cc2d1a T C 8: 84,134,669 T796A probably damaging Het
Cd200r1 T C 16: 44,790,011 S161P possibly damaging Het
Cenpj A G 14: 56,530,048 probably null Het
Chd9 A G 8: 91,033,950 T2108A possibly damaging Het
Cherp TGGAGCG T 8: 72,462,059 probably benign Het
Cnot11 T C 1: 39,542,494 V372A probably damaging Het
Cntnap5b T C 1: 100,164,070 C179R probably damaging Het
Cntrl T A 2: 35,170,500 N1901K probably benign Het
Coil CTGG C 11: 88,981,830 probably benign Het
Col1a1 A G 11: 94,943,040 D488G probably damaging Het
Coro1a T C 7: 126,701,852 H130R probably damaging Het
Crybg3 A C 16: 59,556,704 S1396A possibly damaging Het
Csf2rb2 A G 15: 78,291,926 I259T probably benign Het
Cyp1a2 G T 9: 57,681,970 P187Q probably damaging Het
Cyp3a13 CATTATT CATT 5: 137,894,263 probably null Het
Dcun1d3 T C 7: 119,859,503 E103G possibly damaging Het
Dmkn T A 7: 30,769,704 probably null Het
Dna2 T C 10: 62,966,695 L864P probably damaging Het
Dnah14 T A 1: 181,685,809 M1909K probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Efna5 T C 17: 62,613,394 S163G probably benign Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Ercc4 C T 16: 13,123,507 S253L possibly damaging Het
Flywch1 ACCCA ACCCAATTCTGGTGTGGGGAGGCTACGTACTCTCCCA 17: 23,762,164 probably null Het
Flywch1 CCTGGTGT CCTGGTGTGGGGAGGCTACGTACTCACCCACTTCTGGTGT 17: 23,762,171 probably null Het
Folh1 T C 7: 86,775,687 T25A probably benign Het
Foxi3 C A 6: 70,960,861 T359K possibly damaging Het
Gab3 TCT TCTGCT X: 74,999,996 probably benign Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gab3 TTC TTCATC X: 75,000,025 probably benign Het
Gba2 G T 4: 43,569,894 L440M probably damaging Het
Gm14412 T A 2: 177,315,701 N134Y possibly damaging Het
Gpr88 A G 3: 116,252,369 S98P probably benign Het
Il1r1 A G 1: 40,313,278 Y539C probably damaging Het
Iqcf4 TTTCCTTTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTCTTCCTTTTCCTTTT 9: 106,570,609 probably benign Het
Lce1m CTGCT CTGCTTCCACTGTTGCT 3: 93,018,144 probably benign Het
Lkaaear1 T TATCTCCAGCTCC 2: 181,697,559 probably benign Het
Lkaaear1 CAGCTCCAGCTCCAGCTCCAGCTC CAGCTCCAGCTCTAGCTCCAGCTCCAGCTCCAGCTC 2: 181,697,577 probably benign Het
Ltb4r1 T A 14: 55,767,969 L243Q possibly damaging Het
Man2a1 T A 17: 64,712,253 V704D probably damaging Het
Map1a CTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGTTCCAGCTCCA 2: 121,306,308 probably benign Het
Mcu G T 10: 59,491,116 A63E probably benign Het
Mrps31 A T 8: 22,419,864 D182V possibly damaging Het
Mslnl T A 17: 25,743,228 V200E possibly damaging Het
Naip1 A T 13: 100,426,134 M841K probably benign Het
Ndufab1 T C 7: 122,096,638 K88E possibly damaging Het
Nlrp5 A C 7: 23,418,161 I437L probably benign Het
Nnt C T 13: 119,396,857 V91M probably damaging Het
Nusap1 TACACGTTAGCAGTGAGGAGCAAGCTGAGA TACACGTTAGCAGTGAGGAGCAAGCTGAGAGACACGTTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,581 probably benign Het
Nynrin T G 14: 55,866,201 probably null Het
Olfr358 T G 2: 37,005,174 T147P probably damaging Het
Olfr773 T A 10: 129,186,693 I243F probably damaging Het
Olfr992 C A 2: 85,399,793 A247S probably damaging Het
Osbpl8 A G 10: 111,276,467 K481R possibly damaging Het
Padi6 T C 4: 140,729,743 D540G probably damaging Het
Pcmtd1 T C 1: 7,155,105 probably benign Het
Pdik1l TTTTTGTTTT TTTTTGTTTTGGTTTTGTTTT 4: 134,279,368 probably null Het
Phospho1 T C 11: 95,831,055 Y184H probably damaging Het
Pi4ka T A 16: 17,297,233 R1431W Het
Plxdc1 T A 11: 97,978,678 H28L probably benign Het
Pnmal1 ACCTCATGATGCACCTGCTTCAACA ACCTCATGATGCACCTGCTTCAACACCTCATGATGCACCTGCTTCAACA 7: 16,961,424 probably benign Het
Ppp1r7 T C 1: 93,346,289 probably null Het
Ppp1r9a T A 6: 4,906,657 V404E probably damaging Het
Scfd1 T A 12: 51,422,973 S434T probably benign Het
Six5 A G 7: 19,094,937 S101G probably benign Het
Slc6a4 C A 11: 77,019,182 T421K probably damaging Het
Smarcd3 C A 5: 24,596,070 R113L probably damaging Het
Son T A 16: 91,659,369 M1668K possibly damaging Het
Tcf25 A G 8: 123,395,630 D434G probably benign Het
Tcof1 CCAGAGATCCCC CCAGAGATCCCCGTGGCTGCCGAGATGGGCACTTTCACAGAGATCCCC 18: 60,833,568 probably benign Het
Tep1 A G 14: 50,860,945 V463A possibly damaging Het
Thegl CTCCCCAGTCCCGCAAGGCCAG CTCCCCAGTCCCGCAAGGCCAGCGATCGTCCCCAGTCCCGCAAGGCCAG 5: 77,016,408 probably benign Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 AAG AAGCAG 14: 53,649,755 probably benign Het
Trim24 A G 6: 37,953,536 K642E possibly damaging Het
Trim33 GGCCCCCGC GGC 3: 103,280,217 probably benign Het
Triobp CTCCCTGTGCCCAACGG CTCCCTGTGCCCAACGGAACAACCCCAGGATTCCCTGTGCCCAACGG 15: 78,967,044 probably benign Het
Trmu G T 15: 85,892,569 V161L possibly damaging Het
Try4 T A 6: 41,305,363 C206S probably damaging Het
Usp2 TTCACTTAC TTCACTTACTCATGTGACCTGTTCGTCACTTAC 9: 44,089,121 probably benign Het
Vmn1r62 A T 7: 5,675,670 M117L probably benign Het
Vmn2r104 A T 17: 20,048,040 Y56N probably benign Het
Wdr66 G GGAT 5: 123,254,254 probably benign Het
Xxylt1 C T 16: 31,050,680 D201N possibly damaging Het
Zfp563 T A 17: 33,105,025 I198K probably benign Het
Zfp612 T A 8: 110,089,542 C460* probably null Het
Zfp691 G A 4: 119,170,735 T100M probably benign Het
Zfp773 A T 7: 7,132,690 C302* probably null Het
Zmat2 A G 18: 36,797,883 E154G probably damaging Het
Zw10 T A 9: 49,060,920 I132N possibly damaging Het
Other mutations in Ahnak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ahnak APN 19 9007223 missense probably damaging 0.99
IGL00509:Ahnak APN 19 9009951 missense possibly damaging 0.94
IGL00539:Ahnak APN 19 9007908 missense possibly damaging 0.50
IGL00558:Ahnak APN 19 9004307 missense possibly damaging 0.93
IGL00567:Ahnak APN 19 9013383 missense probably benign 0.24
IGL00706:Ahnak APN 19 9013730 nonsense probably null
IGL00807:Ahnak APN 19 9008522 missense possibly damaging 0.92
IGL00870:Ahnak APN 19 9013698 missense probably damaging 1.00
IGL01101:Ahnak APN 19 9012887 intron probably benign
IGL01118:Ahnak APN 19 9012578 missense probably damaging 1.00
IGL01288:Ahnak APN 19 9002494 missense possibly damaging 0.94
IGL01324:Ahnak APN 19 9003032 missense probably damaging 1.00
IGL01341:Ahnak APN 19 9011703 missense probably benign
IGL01541:Ahnak APN 19 9007879 missense possibly damaging 0.95
IGL01580:Ahnak APN 19 9002839 missense probably benign 0.02
IGL01595:Ahnak APN 19 9003501 nonsense probably null
IGL01746:Ahnak APN 19 9004912 missense possibly damaging 0.89
IGL01766:Ahnak APN 19 9000118 missense unknown
IGL01821:Ahnak APN 19 9012118 missense probably benign
IGL01913:Ahnak APN 19 9006064 nonsense probably null
IGL01934:Ahnak APN 19 9002657 missense probably damaging 1.00
IGL01940:Ahnak APN 19 9006557 missense probably benign 0.14
IGL01958:Ahnak APN 19 9014909 missense possibly damaging 0.59
IGL02145:Ahnak APN 19 9002855 missense probably benign 0.11
IGL02246:Ahnak APN 19 9008268 missense probably damaging 1.00
IGL02282:Ahnak APN 19 9005987 missense probably damaging 1.00
IGL02428:Ahnak APN 19 9014833 missense possibly damaging 0.83
IGL02442:Ahnak APN 19 9004016 missense probably damaging 1.00
IGL02474:Ahnak APN 19 9004933 missense probably benign 0.13
IGL02483:Ahnak APN 19 9003308 missense probably benign 0.01
IGL02616:Ahnak APN 19 9005627 missense probably benign 0.03
IGL02630:Ahnak APN 19 9012077 missense probably damaging 1.00
IGL02690:Ahnak APN 19 9012584 nonsense probably null
IGL02717:Ahnak APN 19 9002387 missense probably benign 0.00
IGL02721:Ahnak APN 19 9009707 missense probably benign 0.07
IGL02737:Ahnak APN 19 9004593 missense probably benign 0.17
IGL02850:Ahnak APN 19 9002596 missense probably benign 0.00
IGL03071:Ahnak APN 19 9011918 missense possibly damaging 0.63
IGL03072:Ahnak APN 19 9006508 missense probably benign 0.11
IGL03094:Ahnak APN 19 9003547 missense possibly damaging 0.64
IGL03140:Ahnak APN 19 9005212 intron probably benign
IGL03176:Ahnak APN 19 9008166 missense possibly damaging 0.56
IGL03176:Ahnak APN 19 9002449 missense probably damaging 1.00
IGL03189:Ahnak APN 19 9011239 missense possibly damaging 0.65
IGL03357:Ahnak APN 19 9009325 intron probably benign
IGL03371:Ahnak APN 19 9004228 missense possibly damaging 0.91
Eskimo UTSW 19 9009574 missense probably benign 0.31
Nanook UTSW 19 9003231 missense probably benign 0.42
Netsilik UTSW 19 9002321 missense probably benign 0.00
IGL03097:Ahnak UTSW 19 9002387 missense probably benign 0.00
PIT4403001:Ahnak UTSW 19 9006176 missense possibly damaging 0.87
R0054:Ahnak UTSW 19 9012056 missense probably damaging 1.00
R0094:Ahnak UTSW 19 9013893 missense probably benign 0.12
R0110:Ahnak UTSW 19 9018232 nonsense probably null
R0141:Ahnak UTSW 19 9006680 missense probably damaging 1.00
R0166:Ahnak UTSW 19 9005725 missense probably damaging 1.00
R0309:Ahnak UTSW 19 9002495 missense probably damaging 1.00
R0368:Ahnak UTSW 19 9008350 nonsense probably null
R0386:Ahnak UTSW 19 9011144 missense possibly damaging 0.94
R0401:Ahnak UTSW 19 9015116 missense probably benign 0.24
R0415:Ahnak UTSW 19 9012871 intron probably benign
R0463:Ahnak UTSW 19 9009407 intron probably benign
R0469:Ahnak UTSW 19 9018232 nonsense probably null
R0470:Ahnak UTSW 19 9008967 missense probably benign 0.29
R0487:Ahnak UTSW 19 9007151 missense probably benign 0.00
R0487:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R0499:Ahnak UTSW 19 9000264 splice site probably benign
R0506:Ahnak UTSW 19 9009128 missense probably damaging 1.00
R0510:Ahnak UTSW 19 9018232 nonsense probably null
R0557:Ahnak UTSW 19 9001944 missense probably benign 0.10
R0570:Ahnak UTSW 19 9013698 missense probably damaging 1.00
R0610:Ahnak UTSW 19 9007878 missense probably benign 0.08
R0646:Ahnak UTSW 19 9013402 nonsense probably null
R0659:Ahnak UTSW 19 9015002 missense possibly damaging 0.60
R0791:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0792:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0840:Ahnak UTSW 19 9005063 missense probably damaging 1.00
R0847:Ahnak UTSW 19 9006433 nonsense probably null
R0941:Ahnak UTSW 19 9009914 missense probably damaging 1.00
R0962:Ahnak UTSW 19 9012848 intron probably benign
R1017:Ahnak UTSW 19 9010543 missense probably damaging 0.99
R1037:Ahnak UTSW 19 9007618 missense probably benign 0.27
R1085:Ahnak UTSW 19 9013125 missense possibly damaging 0.50
R1113:Ahnak UTSW 19 9005620 missense probably benign 0.29
R1140:Ahnak UTSW 19 9004245 missense probably damaging 1.00
R1158:Ahnak UTSW 19 9013926 missense probably benign 0.00
R1218:Ahnak UTSW 19 9015619 missense probably damaging 1.00
R1225:Ahnak UTSW 19 9002883 missense probably damaging 1.00
R1245:Ahnak UTSW 19 9004169 missense probably benign 0.44
R1421:Ahnak UTSW 19 9015631 missense possibly damaging 0.95
R1447:Ahnak UTSW 19 9007082 missense probably damaging 0.98
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1471:Ahnak UTSW 19 9012932 intron probably benign
R1507:Ahnak UTSW 19 9010077 missense probably damaging 1.00
R1521:Ahnak UTSW 19 9004728 missense probably benign 0.11
R1568:Ahnak UTSW 19 9002375 missense probably damaging 0.98
R1569:Ahnak UTSW 19 9004094 missense possibly damaging 0.78
R1616:Ahnak UTSW 19 9008987 missense possibly damaging 0.94
R1638:Ahnak UTSW 19 9009449 missense probably benign 0.01
R1680:Ahnak UTSW 19 9009963 missense probably benign 0.05
R1713:Ahnak UTSW 19 9011809 missense possibly damaging 0.95
R1722:Ahnak UTSW 19 9010655 missense probably damaging 0.99
R1771:Ahnak UTSW 19 9013753 missense probably benign 0.24
R1795:Ahnak UTSW 19 9002438 missense possibly damaging 0.79
R1823:Ahnak UTSW 19 9004905 missense probably damaging 0.99
R1842:Ahnak UTSW 19 9005867 missense probably damaging 0.99
R1854:Ahnak UTSW 19 9013832 missense possibly damaging 0.61
R1856:Ahnak UTSW 19 9002048 missense possibly damaging 0.86
R1886:Ahnak UTSW 19 9015979 missense probably damaging 0.98
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1912:Ahnak UTSW 19 9017881 missense probably damaging 1.00
R1913:Ahnak UTSW 19 9007922 missense probably damaging 0.99
R1942:Ahnak UTSW 19 9015083 missense probably damaging 0.98
R1987:Ahnak UTSW 19 9015251 missense probably damaging 1.00
R2006:Ahnak UTSW 19 9007075 missense probably damaging 1.00
R2013:Ahnak UTSW 19 9014573 missense probably damaging 0.98
R2014:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R2047:Ahnak UTSW 19 9014300 missense possibly damaging 0.67
R2048:Ahnak UTSW 19 9007056 missense probably damaging 0.99
R2060:Ahnak UTSW 19 9008041 missense probably benign 0.08
R2083:Ahnak UTSW 19 9011557 missense probably damaging 1.00
R2157:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R2167:Ahnak UTSW 19 9011494 nonsense probably null
R2208:Ahnak UTSW 19 9017732 missense probably benign 0.00
R2224:Ahnak UTSW 19 9012991 intron probably benign
R2268:Ahnak UTSW 19 9010574 missense possibly damaging 0.66
R2420:Ahnak UTSW 19 9009256 missense possibly damaging 0.89
R2426:Ahnak UTSW 19 9002851 missense possibly damaging 0.81
R2910:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2911:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2981:Ahnak UTSW 19 9000148 missense probably damaging 0.97
R3151:Ahnak UTSW 19 9009944 missense probably benign 0.12
R3155:Ahnak UTSW 19 9010177 missense possibly damaging 0.49
R3422:Ahnak UTSW 19 9005708 missense probably benign 0.39
R3422:Ahnak UTSW 19 9006752 missense probably benign 0.05
R3430:Ahnak UTSW 19 9006958 missense probably benign 0.42
R3433:Ahnak UTSW 19 9009994 missense probably benign 0.01
R3711:Ahnak UTSW 19 9007898 missense probably benign
R3723:Ahnak UTSW 19 9016853 missense possibly damaging 0.79
R3775:Ahnak UTSW 19 9009023 missense possibly damaging 0.91
R3858:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3859:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3922:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3924:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3926:Ahnak UTSW 19 9006328 missense probably benign 0.20
R4026:Ahnak UTSW 19 9011299 missense probably damaging 0.97
R4051:Ahnak UTSW 19 9014327 missense probably damaging 1.00
R4209:Ahnak UTSW 19 9002600 missense probably damaging 1.00
R4234:Ahnak UTSW 19 9000786 nonsense probably null
R4237:Ahnak UTSW 19 9001783 missense probably benign 0.02
R4285:Ahnak UTSW 19 9016839 nonsense probably null
R4331:Ahnak UTSW 19 9015820 missense probably damaging 1.00
R4342:Ahnak UTSW 19 9012083 missense possibly damaging 0.79
R4430:Ahnak UTSW 19 9003040 missense probably benign 0.00
R4554:Ahnak UTSW 19 9014930 missense probably damaging 1.00
R4602:Ahnak UTSW 19 9010825 missense possibly damaging 0.66
R4612:Ahnak UTSW 19 9003724 missense probably benign 0.44
R4655:Ahnak UTSW 19 9008701 missense probably damaging 1.00
R4656:Ahnak UTSW 19 9004855 missense possibly damaging 0.80
R4700:Ahnak UTSW 19 9004681 missense probably benign 0.02
R4704:Ahnak UTSW 19 9012258 intron probably benign
R4704:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R4705:Ahnak UTSW 19 9016906 missense probably benign 0.07
R4707:Ahnak UTSW 19 9016735 missense probably benign 0.03
R4732:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4733:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4778:Ahnak UTSW 19 9011975 missense possibly damaging 0.79
R4782:Ahnak UTSW 19 9012499 intron probably benign
R4832:Ahnak UTSW 19 9012460 intron probably benign
R4882:Ahnak UTSW 19 9005897 missense probably damaging 0.98
R4884:Ahnak UTSW 19 9012754 intron probably benign
R4895:Ahnak UTSW 19 9017441 missense probably benign 0.43
R4930:Ahnak UTSW 19 9010967 missense possibly damaging 0.79
R4951:Ahnak UTSW 19 9017835 missense probably damaging 1.00
R4968:Ahnak UTSW 19 9015100 missense probably damaging 1.00
R5026:Ahnak UTSW 19 9010631 missense possibly damaging 0.46
R5050:Ahnak UTSW 19 9012458 intron probably benign
R5073:Ahnak UTSW 19 9003231 missense probably benign 0.42
R5110:Ahnak UTSW 19 9014759 missense probably damaging 1.00
R5119:Ahnak UTSW 19 9013644 missense probably benign 0.00
R5128:Ahnak UTSW 19 9017087 missense probably damaging 1.00
R5139:Ahnak UTSW 19 9004655 missense probably damaging 1.00
R5150:Ahnak UTSW 19 9010904 missense possibly damaging 0.46
R5151:Ahnak UTSW 19 9017569 missense probably benign 0.03
R5165:Ahnak UTSW 19 9015665 missense possibly damaging 0.95
R5236:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R5361:Ahnak UTSW 19 9015341 missense possibly damaging 0.92
R5366:Ahnak UTSW 19 9016735 missense possibly damaging 0.65
R5387:Ahnak UTSW 19 9003691 missense probably damaging 1.00
R5396:Ahnak UTSW 19 9007175 missense probably damaging 0.99
R5583:Ahnak UTSW 19 9006917 missense probably damaging 0.99
R5587:Ahnak UTSW 19 9009476 missense possibly damaging 0.88
R5620:Ahnak UTSW 19 9013094 nonsense probably null
R5643:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5644:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5657:Ahnak UTSW 19 9014615 missense probably damaging 0.99
R5688:Ahnak UTSW 19 9002519 missense probably benign 0.01
R5702:Ahnak UTSW 19 9001840 missense probably damaging 1.00
R5727:Ahnak UTSW 19 9016747 missense probably damaging 0.99
R5730:Ahnak UTSW 19 9010253 missense possibly damaging 0.81
R5755:Ahnak UTSW 19 9001732 missense probably benign 0.06
R5760:Ahnak UTSW 19 9013562 missense probably damaging 1.00
R5789:Ahnak UTSW 19 9002321 missense probably benign 0.00
R5790:Ahnak UTSW 19 9015248 missense probably damaging 0.99
R5795:Ahnak UTSW 19 9012382 nonsense probably null
R5808:Ahnak UTSW 19 9010235 missense possibly damaging 0.91
R5867:Ahnak UTSW 19 9010052 missense probably damaging 0.99
R5878:Ahnak UTSW 19 9008342 missense probably damaging 1.00
R5898:Ahnak UTSW 19 9013767 missense possibly damaging 0.63
R5898:Ahnak UTSW 19 9018211 missense probably damaging 1.00
R5912:Ahnak UTSW 19 9011903 missense probably damaging 0.99
R5935:Ahnak UTSW 19 9015182 missense possibly damaging 0.91
R5969:Ahnak UTSW 19 9016585 missense probably damaging 1.00
R5988:Ahnak UTSW 19 9009347 intron probably benign
R6000:Ahnak UTSW 19 9013111 nonsense probably null
R6005:Ahnak UTSW 19 9015161 missense possibly damaging 0.61
R6101:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6105:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6116:Ahnak UTSW 19 9012963 intron probably benign
R6209:Ahnak UTSW 19 9012566 missense probably damaging 1.00
R6240:Ahnak UTSW 19 9013583 missense probably damaging 1.00
R6255:Ahnak UTSW 19 9008025 missense possibly damaging 0.95
R6263:Ahnak UTSW 19 9018277 missense probably benign 0.03
R6287:Ahnak UTSW 19 9015003 missense probably benign 0.02
R6296:Ahnak UTSW 19 9003305 missense probably damaging 0.99
R6315:Ahnak UTSW 19 9006626 missense probably damaging 0.99
R6328:Ahnak UTSW 19 9007148 missense probably benign 0.11
R6331:Ahnak UTSW 19 9006625 missense probably benign 0.18
R6355:Ahnak UTSW 19 9008762 missense probably benign 0.02
R6409:Ahnak UTSW 19 9009574 missense probably benign 0.31
R6567:Ahnak UTSW 19 9008806 missense probably benign 0.27
R6572:Ahnak UTSW 19 9007976 missense probably damaging 0.99
R6574:Ahnak UTSW 19 9017047 missense probably benign 0.04
R6590:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6620:Ahnak UTSW 19 9015310 missense possibly damaging 0.95
R6690:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6731:Ahnak UTSW 19 9011562 missense possibly damaging 0.85
R6756:Ahnak UTSW 19 9007561 missense possibly damaging 0.59
R6846:Ahnak UTSW 19 9011857 missense possibly damaging 0.66
R6854:Ahnak UTSW 19 9015235 missense probably damaging 1.00
R6857:Ahnak UTSW 19 9037168 nonsense probably null
R6863:Ahnak UTSW 19 9012365 intron probably benign
R6876:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R6958:Ahnak UTSW 19 9015215 missense possibly damaging 0.88
R7126:Ahnak UTSW 19 9002359 missense possibly damaging 0.61
R7181:Ahnak UTSW 19 9013488 missense probably damaging 1.00
R7183:Ahnak UTSW 19 9017668 missense probably damaging 1.00
R7202:Ahnak UTSW 19 9017799 missense probably damaging 1.00
R7235:Ahnak UTSW 19 9012488 missense unknown
R7241:Ahnak UTSW 19 9009031 missense possibly damaging 0.65
R7269:Ahnak UTSW 19 9006617 missense probably damaging 1.00
R7311:Ahnak UTSW 19 9002143 missense probably benign 0.04
R7311:Ahnak UTSW 19 9009827 missense possibly damaging 0.56
R7329:Ahnak UTSW 19 9001792 missense probably damaging 0.99
R7339:Ahnak UTSW 19 9008165 missense possibly damaging 0.75
R7390:Ahnak UTSW 19 9003205 missense probably benign 0.02
R7400:Ahnak UTSW 19 9014613 missense probably damaging 0.99
R7444:Ahnak UTSW 19 9007423 missense probably benign 0.08
R7483:Ahnak UTSW 19 9004822 missense probably damaging 1.00
R7498:Ahnak UTSW 19 9012019 missense probably benign 0.14
R7521:Ahnak UTSW 19 9002351 missense possibly damaging 0.89
R7522:Ahnak UTSW 19 9002322 missense probably benign 0.01
R7552:Ahnak UTSW 19 9006824 missense probably benign 0.18
R7563:Ahnak UTSW 19 9011165 missense probably damaging 0.99
R7565:Ahnak UTSW 19 9016156 missense probably benign 0.05
R7571:Ahnak UTSW 19 9000786 nonsense probably null
R7583:Ahnak UTSW 19 9006093 missense possibly damaging 0.90
R7600:Ahnak UTSW 19 9004574 missense possibly damaging 0.89
R7771:Ahnak UTSW 19 9015047 missense probably damaging 0.99
R7787:Ahnak UTSW 19 9009315 missense unknown
R7827:Ahnak UTSW 19 9005344 nonsense probably null
R7857:Ahnak UTSW 19 9007468 missense probably damaging 0.97
R7916:Ahnak UTSW 19 9005832 missense possibly damaging 0.66
R7939:Ahnak UTSW 19 9014084 nonsense probably null
R7959:Ahnak UTSW 19 9010649 missense possibly damaging 0.46
R7962:Ahnak UTSW 19 9012800 missense unknown
R7979:Ahnak UTSW 19 9011432 missense probably damaging 1.00
R8006:Ahnak UTSW 19 9012083 missense possibly damaging 0.79
R8013:Ahnak UTSW 19 9009335 missense unknown
R8033:Ahnak UTSW 19 9003710 missense probably benign 0.10
R8124:Ahnak UTSW 19 9007123 missense probably damaging 0.99
R8125:Ahnak UTSW 19 9011876 missense possibly damaging 0.95
R8129:Ahnak UTSW 19 9000100 start codon destroyed not run
R8151:Ahnak UTSW 19 9004679 missense possibly damaging 0.59
R8190:Ahnak UTSW 19 9002255 missense probably benign 0.01
R8221:Ahnak UTSW 19 9010436 nonsense probably null
R8241:Ahnak UTSW 19 9007295 missense probably benign 0.15
R8244:Ahnak UTSW 19 9015673 missense probably benign 0.44
R8248:Ahnak UTSW 19 9001946 missense probably damaging 1.00
R8261:Ahnak UTSW 19 9005453 missense probably damaging 1.00
R8330:Ahnak UTSW 19 9009662 missense possibly damaging 0.86
R8380:Ahnak UTSW 19 9017855 missense probably benign 0.05
R8407:Ahnak UTSW 19 9015673 missense probably benign 0.44
R8409:Ahnak UTSW 19 9015673 missense probably benign 0.44
R8511:Ahnak UTSW 19 9012355 missense unknown
X0021:Ahnak UTSW 19 9013619 missense probably damaging 0.99
X0027:Ahnak UTSW 19 9012037 missense probably damaging 1.00
Z1088:Ahnak UTSW 19 9016082 missense probably damaging 0.99
Z1176:Ahnak UTSW 19 9008856 missense probably damaging 0.97
Z1177:Ahnak UTSW 19 9017468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCCCTAAGTTTAAAATGCC -3'
(R):5'- GCATCTTGAACTTGGGACCC -3'

Sequencing Primer
(F):5'- GGGCCCTAAGTTTAAAATGCCTGATC -3'
(R):5'- TGAACTTGGGACCCTTCAGC -3'
Posted On2019-12-04