Incidental Mutation 'RF008:Cemip'
ID602985
Institutional Source Beutler Lab
Gene Symbol Cemip
Ensembl Gene ENSMUSG00000052353
Gene Namecell migration inducing protein, hyaluronan binding
Synonyms6330404C01Rik, 9930013L23Rik, 12H19.01.T7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #RF008 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location83932857-84086502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83961635 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 704 (T704A)
Ref Sequence ENSEMBL: ENSMUSP00000063277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064174]
Predicted Effect probably damaging
Transcript: ENSMUST00000064174
AA Change: T704A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: T704A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
G8 44 166 9.01e-42 SMART
Pfam:ILEI 187 281 2.1e-28 PFAM
Pfam:Mucin2_WxxW 324 403 1.2e-13 PFAM
PbH1 572 594 7.34e3 SMART
PbH1 595 617 3.73e3 SMART
PbH1 719 741 4.11e3 SMART
PbH1 798 819 6.96e2 SMART
Blast:PbH1 844 882 7e-17 BLAST
Blast:PbH1 917 952 2e-15 BLAST
Pfam:ILEI 1244 1334 2.7e-17 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,765,767 R8H probably benign Het
Abi3bp CCACGACC CCACGACCACGACC 16: 56,627,589 probably benign Het
Acan T G 7: 79,092,400 V515G possibly damaging Het
Acap3 TGG TGGACTGCTGCATCCAGG 4: 155,905,098 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,924 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arid1b GCG GCGACG 17: 4,995,594 probably benign Het
Arid1b CGG CGGAGG 17: 4,995,595 probably benign Het
Begain G GCCGCCC 12: 109,033,437 probably null Het
Cacna1e A G 1: 154,442,136 M1500T probably damaging Het
Ccdc174 T C 6: 91,899,366 S395P possibly damaging Het
Ccdc7a T G 8: 128,964,953 Q396H probably damaging Het
Ccdc85c CC CCGGC 12: 108,274,628 probably benign Het
Col7a1 C T 9: 108,964,479 P1370S unknown Het
Cts8 T C 13: 61,249,288 I273V probably benign Het
Cyp2c50 T A 19: 40,089,824 I42N probably damaging Het
Dbt T G 3: 116,548,068 Y439* probably null Het
Dennd1b T A 1: 139,053,397 D116E probably damaging Het
Dkk2 T A 3: 132,178,102 H254Q probably damaging Het
Dpy30 C A 17: 74,315,907 V27F possibly damaging Het
Efhd2 GCCGCC GCCGCCCCCGCC 4: 141,874,758 probably benign Het
Eif4g3 A T 4: 138,175,924 E1020V probably damaging Het
Elmo1 T A 13: 20,274,536 S156T probably benign Het
Fancd2os T C 6: 113,597,920 T42A probably damaging Het
Fbrsl1 TGTGC TGTGCGGGTGTGGGTGC 5: 110,378,118 probably benign Het
Fsip2 T C 2: 82,977,840 V1501A probably benign Het
Gabrb2 A G 11: 42,626,878 Y509C probably damaging Het
Gm8369 GTGT GTGTTTGT 19: 11,511,754 probably null Het
Gpr139 T C 7: 119,144,867 D165G probably benign Het
Grik2 T C 10: 49,244,384 E603G probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Ifitm10 T A 7: 142,328,593 M147L unknown Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Krtap28-10 CAGCCA CAGCCATAGCCA 1: 83,042,128 probably benign Het
Krtap28-10 AGCCAC AGCCACCGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 ACCACAGCCACAGCCACCACAGCCACAGCCACCACAGC ACCACAGCCACAGCCACCACAGCCACAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,253 probably benign Het
Krtap28-10 AGCCACCACAGC AGCCACCACAGCCACCGCCACCACAGC 1: 83,042,279 probably benign Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Mical2 T C 7: 112,323,626 Y613H probably damaging Het
Mlf2 C A 6: 124,934,296 H91Q probably benign Het
Nat9 A T 11: 115,183,386 I152N probably damaging Het
Olfr1248 A T 2: 89,617,367 I275N possibly damaging Het
Olfr961 T C 9: 39,647,263 M179T probably benign Het
Pdik1l CACCAC CACCACAACCAC 4: 134,279,511 probably benign Het
Phldb2 T C 16: 45,762,974 S1054G probably damaging Het
Pkhd1l1 TTTT TTTTTTTTTTGTTT 15: 44,558,505 probably benign Het
Prdm16 T A 4: 154,341,995 R444S probably damaging Het
Rgs6 T C 12: 83,063,449 F163L probably damaging Het
Rnaseh2a A T 8: 84,960,058 L154* probably null Het
Rpp38 A G 2: 3,329,035 S277P unknown Het
Setd1a GGTAGTGGT GGTAGTGGTTGTAGTGGT 7: 127,785,314 probably benign Het
Shisa6 CGACAGCAGCAGAG CG 11: 66,525,923 probably benign Het
Slc27a2 T A 2: 126,553,255 L34Q possibly damaging Het
Slc7a6 G A 8: 106,195,398 V386I probably benign Het
Spry1 C T 3: 37,643,115 T169I possibly damaging Het
Sry TGCTGCTGCTG TGCTGCTGCTGCTG Y: 2,662,826 probably benign Het
Stk24 A T 14: 121,294,760 I275N probably benign Het
Strn TC TCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGGC 17: 78,677,287 probably null Het
Tcp11l2 C A 10: 84,613,524 P451Q probably damaging Het
Tfeb AGC AGCTGC 17: 47,786,102 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,289 probably benign Het
V1ra8 A G 6: 90,203,609 T265A probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Zfp612 C A 8: 110,089,561 H467N probably damaging Het
Zfp777 A T 6: 48,042,048 Y317* probably null Het
Znrd1as CACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCAC 17: 36,965,054 probably benign Het
Other mutations in Cemip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Cemip APN 7 83947280 missense possibly damaging 0.63
IGL01520:Cemip APN 7 83948622 missense probably benign 0.27
IGL01646:Cemip APN 7 83983232 missense possibly damaging 0.81
IGL02057:Cemip APN 7 83987453 missense probably damaging 1.00
IGL02058:Cemip APN 7 83997292 missense probably damaging 0.99
IGL02120:Cemip APN 7 83951563 missense probably damaging 0.99
IGL02278:Cemip APN 7 83937438 missense probably damaging 1.00
IGL02331:Cemip APN 7 83963984 critical splice donor site probably null
IGL02366:Cemip APN 7 83943641 missense probably benign 0.08
IGL02434:Cemip APN 7 83955284 missense probably damaging 0.98
IGL02622:Cemip APN 7 83964175 missense probably damaging 1.00
IGL02958:Cemip APN 7 83975055 missense probably damaging 0.99
IGL02979:Cemip APN 7 84003306 splice site probably benign
IGL03280:Cemip APN 7 83987330 splice site probably benign
IGL03400:Cemip APN 7 83958516 missense probably damaging 0.96
IGL03134:Cemip UTSW 7 83999237 missense probably damaging 1.00
PIT4618001:Cemip UTSW 7 83943939 missense probably benign 0.07
R0149:Cemip UTSW 7 83964010 missense probably benign
R0212:Cemip UTSW 7 83973190 missense probably damaging 0.99
R0361:Cemip UTSW 7 83964010 missense probably benign
R0565:Cemip UTSW 7 83964110 missense probably damaging 0.99
R0727:Cemip UTSW 7 83961578 missense probably benign 0.00
R1342:Cemip UTSW 7 83944075 nonsense probably null
R1456:Cemip UTSW 7 83998510 missense possibly damaging 0.96
R1526:Cemip UTSW 7 83951440 missense probably damaging 1.00
R1676:Cemip UTSW 7 83964038 missense possibly damaging 0.77
R1718:Cemip UTSW 7 83935658 missense probably benign 0.00
R2234:Cemip UTSW 7 83998562 missense probably benign 0.02
R2513:Cemip UTSW 7 83942025 missense probably benign 0.11
R3788:Cemip UTSW 7 83943898 missense probably damaging 1.00
R3964:Cemip UTSW 7 83951509 missense probably benign 0.43
R3966:Cemip UTSW 7 83951509 missense probably benign 0.43
R4436:Cemip UTSW 7 83987429 missense probably null 0.43
R4584:Cemip UTSW 7 83958539 missense probably damaging 1.00
R4601:Cemip UTSW 7 83951618 missense probably damaging 0.98
R4717:Cemip UTSW 7 83947280 missense probably damaging 0.97
R4767:Cemip UTSW 7 83973306 missense probably damaging 1.00
R4822:Cemip UTSW 7 83973241 missense probably benign 0.27
R4849:Cemip UTSW 7 83935737 missense possibly damaging 0.52
R4910:Cemip UTSW 7 83997411 missense probably damaging 1.00
R4911:Cemip UTSW 7 83983253 missense probably damaging 1.00
R4922:Cemip UTSW 7 83947100 intron probably benign
R4924:Cemip UTSW 7 83952938 missense probably damaging 1.00
R5090:Cemip UTSW 7 83942135 missense probably damaging 1.00
R5310:Cemip UTSW 7 83992033 missense probably damaging 1.00
R5327:Cemip UTSW 7 83955301 missense probably damaging 0.99
R5378:Cemip UTSW 7 83958525 missense probably damaging 1.00
R5444:Cemip UTSW 7 83982291 missense probably damaging 0.98
R5644:Cemip UTSW 7 83989184 missense probably benign 0.03
R5688:Cemip UTSW 7 83961641 missense probably damaging 1.00
R5714:Cemip UTSW 7 83975179 missense probably damaging 1.00
R6170:Cemip UTSW 7 83947230 missense possibly damaging 0.89
R6505:Cemip UTSW 7 83951597 nonsense probably null
R6713:Cemip UTSW 7 83943637 missense probably benign 0.03
R6767:Cemip UTSW 7 83998624 missense probably damaging 1.00
R6817:Cemip UTSW 7 83987992 missense probably damaging 1.00
R6896:Cemip UTSW 7 83998576 missense probably damaging 1.00
R6945:Cemip UTSW 7 83998547 missense probably damaging 1.00
R7236:Cemip UTSW 7 83948804 splice site probably null
R7410:Cemip UTSW 7 83952834 missense probably damaging 1.00
R7483:Cemip UTSW 7 83998576 missense probably damaging 0.99
R7734:Cemip UTSW 7 83957664 nonsense probably null
R8005:Cemip UTSW 7 84003408 start gained probably benign
T0970:Cemip UTSW 7 83983146 missense probably damaging 0.99
X0067:Cemip UTSW 7 83947208 missense probably damaging 0.98
Z1177:Cemip UTSW 7 83947296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGGCTCTAATCATCTGCAGG -3'
(R):5'- TTATCCCGGCACTGAACCAC -3'

Sequencing Primer
(F):5'- CTAATCATCTGCAGGTTGGGGC -3'
(R):5'- GCACTGAACCACGTGTATGTG -3'
Posted On2019-12-04