Incidental Mutation 'RF008:Gpr139'
ID 602987
Institutional Source Beutler Lab
Gene Symbol Gpr139
Ensembl Gene ENSMUSG00000066197
Gene Name G protein-coupled receptor 139
Synonyms LOC209776, GPRg1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF008 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 119140747-119184603 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119144867 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 165 (D165G)
Ref Sequence ENSEMBL: ENSMUSP00000081700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084650]
AlphaFold Q80UC8
Predicted Effect probably benign
Transcript: ENSMUST00000084650
AA Change: D165G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000081700
Gene: ENSMUSG00000066197
AA Change: D165G

DomainStartEndE-ValueType
Pfam:7tm_1 35 277 2.9e-18 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhodopsin family of G-protein-coupled receptors. The encoded protein is almost exclusively expressed in the central nervous system. L-tryptophan and L-phenylalanine may act as the physiologic ligands of the encoded protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,765,767 R8H probably benign Het
Abi3bp CCACGACC CCACGACCACGACC 16: 56,627,589 probably benign Het
Acan T G 7: 79,092,400 V515G possibly damaging Het
Acap3 TGG TGGACTGCTGCATCCAGG 4: 155,905,098 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,924 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arid1b GCG GCGACG 17: 4,995,594 probably benign Het
Arid1b CGG CGGAGG 17: 4,995,595 probably benign Het
Begain G GCCGCCC 12: 109,033,437 probably null Het
Cacna1e A G 1: 154,442,136 M1500T probably damaging Het
Casp16-ps C A 17: 23,555,227 probably benign Het
Ccdc174 T C 6: 91,899,366 S395P possibly damaging Het
Ccdc7a T G 8: 128,964,953 Q396H probably damaging Het
Ccdc85c CC CCGGC 12: 108,274,628 probably benign Het
Cemip T C 7: 83,961,635 T704A probably damaging Het
Col7a1 C T 9: 108,964,479 P1370S unknown Het
Cts8 T C 13: 61,249,288 I273V probably benign Het
Cyp2c50 T A 19: 40,089,824 I42N probably damaging Het
Dbt T G 3: 116,548,068 Y439* probably null Het
Dennd1b T A 1: 139,053,397 D116E probably damaging Het
Dkk2 T A 3: 132,178,102 H254Q probably damaging Het
Dpy30 C A 17: 74,315,907 V27F possibly damaging Het
Efhd2 GCCGCC GCCGCCCCCGCC 4: 141,874,758 probably benign Het
Eif4g3 A T 4: 138,175,924 E1020V probably damaging Het
Elmo1 T A 13: 20,274,536 S156T probably benign Het
Fancd2os T C 6: 113,597,920 T42A probably damaging Het
Fbrsl1 TGTGC TGTGCGGGTGTGGGTGC 5: 110,378,118 probably benign Het
Fsip2 T C 2: 82,977,840 V1501A probably benign Het
Gabrb2 A G 11: 42,626,878 Y509C probably damaging Het
Gm8369 GTGT GTGTTTGT 19: 11,511,754 probably null Het
Grik2 T C 10: 49,244,384 E603G probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Ifitm10 T A 7: 142,328,593 M147L unknown Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Kif1b T A 4: 149,251,738 probably null Het
Krtap28-10 CAGCCA CAGCCATAGCCA 1: 83,042,128 probably benign Het
Krtap28-10 AGCCAC AGCCACCGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 ACCACAGCCACAGCCACCACAGCCACAGCCACCACAGC ACCACAGCCACAGCCACCACAGCCACAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,253 probably benign Het
Krtap28-10 AGCCACCACAGC AGCCACCACAGCCACCGCCACCACAGC 1: 83,042,279 probably benign Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Mical2 T C 7: 112,323,626 Y613H probably damaging Het
Mlf2 C A 6: 124,934,296 H91Q probably benign Het
Nat9 A T 11: 115,183,386 I152N probably damaging Het
Olfr1248 A T 2: 89,617,367 I275N possibly damaging Het
Olfr961 T C 9: 39,647,263 M179T probably benign Het
Pdik1l CACCAC CACCACAACCAC 4: 134,279,511 probably benign Het
Phldb2 T C 16: 45,762,974 S1054G probably damaging Het
Pkhd1l1 TTTT TTTTTTTTTTGTTT 15: 44,558,505 probably benign Het
Plcg2 T A 8: 117,573,524 probably null Het
Prdm16 T A 4: 154,341,995 R444S probably damaging Het
Rgs6 T C 12: 83,063,449 F163L probably damaging Het
Rnaseh2a A T 8: 84,960,058 L154* probably null Het
Rpp38 A G 2: 3,329,035 S277P unknown Het
Setd1a GGTAGTGGT GGTAGTGGTTGTAGTGGT 7: 127,785,314 probably benign Het
Shisa6 CGACAGCAGCAGAG CG 11: 66,525,923 probably benign Het
Slc27a2 T A 2: 126,553,255 L34Q possibly damaging Het
Slc7a6 G A 8: 106,195,398 V386I probably benign Het
Spry1 C T 3: 37,643,115 T169I possibly damaging Het
Sry TGCTGCTGCTG TGCTGCTGCTGCTG Y: 2,662,826 probably benign Het
Stk24 A T 14: 121,294,760 I275N probably benign Het
Strn TC TCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGGC 17: 78,677,287 probably null Het
Tcp11l2 C A 10: 84,613,524 P451Q probably damaging Het
Tfeb AGC AGCTGC 17: 47,786,102 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,289 probably benign Het
V1ra8 A G 6: 90,203,609 T265A probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Zfp612 C A 8: 110,089,561 H467N probably damaging Het
Zfp777 A T 6: 48,042,048 Y317* probably null Het
Znrd1as CACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCAC 17: 36,965,054 probably benign Het
Other mutations in Gpr139
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Gpr139 APN 7 119184287 missense probably benign 0.10
IGL02103:Gpr139 APN 7 119145132 missense possibly damaging 0.88
IGL02714:Gpr139 APN 7 119145119 missense possibly damaging 0.90
IGL02893:Gpr139 APN 7 119145143 missense probably damaging 1.00
R0082:Gpr139 UTSW 7 119145045 missense probably benign 0.11
R0542:Gpr139 UTSW 7 119145083 missense probably benign
R1912:Gpr139 UTSW 7 119144879 missense possibly damaging 0.62
R2148:Gpr139 UTSW 7 119144969 missense probably benign 0.08
R4568:Gpr139 UTSW 7 119144805 missense probably damaging 0.97
R4633:Gpr139 UTSW 7 119144405 missense probably damaging 0.99
R5039:Gpr139 UTSW 7 119144942 missense probably benign 0.45
R5186:Gpr139 UTSW 7 119144840 missense probably benign 0.00
R5252:Gpr139 UTSW 7 119145204 missense probably benign 0.13
R6518:Gpr139 UTSW 7 119144511 missense probably damaging 1.00
R6861:Gpr139 UTSW 7 119144652 missense probably benign 0.04
R7194:Gpr139 UTSW 7 119144673 missense possibly damaging 0.66
R7213:Gpr139 UTSW 7 119145099 missense probably benign
R7311:Gpr139 UTSW 7 119144866 missense probably benign 0.06
R7390:Gpr139 UTSW 7 119144612 missense probably benign 0.00
R7705:Gpr139 UTSW 7 119144643 missense probably benign 0.06
R8101:Gpr139 UTSW 7 119184287 missense probably benign 0.10
R8970:Gpr139 UTSW 7 119144811 missense probably damaging 1.00
R9395:Gpr139 UTSW 7 119144588 missense probably benign 0.04
Z1177:Gpr139 UTSW 7 119144513 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CAAGATGGCAGTGGTCTTCC -3'
(R):5'- CCTCTGATCCCTGACAAGATC -3'

Sequencing Primer
(F):5'- ATGGCAGTGGTCTTCCCTGTG -3'
(R):5'- TCTGATCCCTGACAAGATCATAGAAG -3'
Posted On 2019-12-04