Incidental Mutation 'RF008:Setd1a'
ID 602988
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF008 (G1)
Quality Score 217.468
Status Not validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GGTAGTGGT to GGTAGTGGTTGTAGTGGT at 127384486 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000126761] [ENSMUST00000144406] [ENSMUST00000154987]
AlphaFold E9PYH6
Predicted Effect probably benign
Transcript: ENSMUST00000047075
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047157
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154987
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp CCACGACC CCACGACCACGACC 16: 56,447,952 (GRCm39) probably benign Het
Acan T G 7: 78,742,148 (GRCm39) V515G possibly damaging Het
Acap3 TGG TGGACTGCTGCATCCAGG 4: 155,989,555 (GRCm39) probably benign Het
AI837181 G GGCT 19: 5,475,266 (GRCm39) probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,693,977 (GRCm39) probably benign Het
Anks1b G A 10: 89,869,087 (GRCm39) G49D probably damaging Het
Arid1b GCG GCGACG 17: 5,045,869 (GRCm39) probably benign Het
Arid1b CGG CGGAGG 17: 5,045,870 (GRCm39) probably benign Het
Begain G GCCGCCC 12: 108,999,363 (GRCm39) probably null Het
Cacna1e A G 1: 154,317,882 (GRCm39) M1500T probably damaging Het
Casp16 C A 17: 23,774,201 (GRCm39) probably benign Het
Ccdc174 T C 6: 91,876,347 (GRCm39) S395P possibly damaging Het
Ccdc7a T G 8: 129,691,434 (GRCm39) Q396H probably damaging Het
Ccdc85c CC CCGGC 12: 108,240,887 (GRCm39) probably benign Het
Cemip T C 7: 83,610,843 (GRCm39) T704A probably damaging Het
Cfap68 C T 9: 50,677,067 (GRCm39) R8H probably benign Het
Col7a1 C T 9: 108,793,547 (GRCm39) P1370S unknown Het
Cts8 T C 13: 61,397,102 (GRCm39) I273V probably benign Het
Cyp2c50 T A 19: 40,078,268 (GRCm39) I42N probably damaging Het
Dbt T G 3: 116,341,717 (GRCm39) Y439* probably null Het
Dennd1b T A 1: 138,981,135 (GRCm39) D116E probably damaging Het
Dkk2 T A 3: 131,883,863 (GRCm39) H254Q probably damaging Het
Dpy30 C A 17: 74,622,902 (GRCm39) V27F possibly damaging Het
Efhd2 GCCGCC GCCGCCCCCGCC 4: 141,602,069 (GRCm39) probably benign Het
Eif4g3 A T 4: 137,903,235 (GRCm39) E1020V probably damaging Het
Elmo1 T A 13: 20,458,706 (GRCm39) S156T probably benign Het
Fancd2os T C 6: 113,574,881 (GRCm39) T42A probably damaging Het
Fbrsl1 TGTGC TGTGCGGGTGTGGGTGC 5: 110,525,984 (GRCm39) probably benign Het
Fsip2 T C 2: 82,808,184 (GRCm39) V1501A probably benign Het
Gabrb2 A G 11: 42,517,705 (GRCm39) Y509C probably damaging Het
Gm8369 GTGT GTGTTTGT 19: 11,489,118 (GRCm39) probably null Het
Gpr139 T C 7: 118,744,090 (GRCm39) D165G probably benign Het
Grik2 T C 10: 49,120,480 (GRCm39) E603G probably damaging Het
H13 G A 2: 152,511,589 (GRCm39) E30K probably damaging Het
Ifitm10 T A 7: 141,882,330 (GRCm39) M147L unknown Het
Itpkb C T 1: 180,160,887 (GRCm39) R338W probably damaging Het
Kif1b T A 4: 149,336,195 (GRCm39) probably null Het
Krtap28-10 ACCACAGCCACAGCCACCACAGCCACAGCCACCACAGC ACCACAGCCACAGCCACCACAGCCACAGCCACCACAGCCACAGCCACCACAGC 1: 83,019,974 (GRCm39) probably benign Het
Krtap28-10 AGCCACCACAGC AGCCACCACAGCCACCGCCACCACAGC 1: 83,020,000 (GRCm39) probably benign Het
Krtap28-10 CAGCCA CAGCCATAGCCA 1: 83,019,849 (GRCm39) probably benign Het
Krtap28-10 AGCCAC AGCCACCGCCAC 1: 83,019,856 (GRCm39) probably benign Het
Las1l AGTGG AGTGGTGG X: 94,984,422 (GRCm39) probably benign Het
Mical2 T C 7: 111,922,833 (GRCm39) Y613H probably damaging Het
Mlf2 C A 6: 124,911,259 (GRCm39) H91Q probably benign Het
Nat9 A T 11: 115,074,212 (GRCm39) I152N probably damaging Het
Or10d4c T C 9: 39,558,559 (GRCm39) M179T probably benign Het
Or4a75 A T 2: 89,447,711 (GRCm39) I275N possibly damaging Het
Pdik1l CACCAC CACCACAACCAC 4: 134,006,822 (GRCm39) probably benign Het
Phldb2 T C 16: 45,583,337 (GRCm39) S1054G probably damaging Het
Pkhd1l1 TTTT TTTTTTTTTTGTTT 15: 44,421,901 (GRCm39) probably benign Het
Plcg2 T A 8: 118,300,263 (GRCm39) probably null Het
Polr1has CACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCAC 17: 37,275,946 (GRCm39) probably benign Het
Prdm16 T A 4: 154,426,452 (GRCm39) R444S probably damaging Het
Rgs6 T C 12: 83,110,223 (GRCm39) F163L probably damaging Het
Rnaseh2a A T 8: 85,686,687 (GRCm39) L154* probably null Het
Rpp38 A G 2: 3,330,072 (GRCm39) S277P unknown Het
Shisa6 CGACAGCAGCAGAG CG 11: 66,416,749 (GRCm39) probably benign Het
Slc27a2 T A 2: 126,395,175 (GRCm39) L34Q possibly damaging Het
Slc7a6 G A 8: 106,922,030 (GRCm39) V386I probably benign Het
Spry1 C T 3: 37,697,264 (GRCm39) T169I possibly damaging Het
Sry TGCTGCTGCTG TGCTGCTGCTGCTG Y: 2,662,826 (GRCm39) probably benign Het
Stk24 A T 14: 121,532,172 (GRCm39) I275N probably benign Het
Strn TC TCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGGC 17: 78,984,716 (GRCm39) probably null Het
Tcp11l2 C A 10: 84,449,388 (GRCm39) P451Q probably damaging Het
Tfeb AGC AGCTGC 17: 48,097,027 (GRCm39) probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,673,138 (GRCm39) probably benign Het
V1ra8 A G 6: 90,180,591 (GRCm39) T265A probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,355,026 (GRCm39) probably benign Het
Zfp612 C A 8: 110,816,193 (GRCm39) H467N probably damaging Het
Zfp777 A T 6: 48,018,982 (GRCm39) Y317* probably null Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0411:Setd1a UTSW 7 127,395,223 (GRCm39) unclassified probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1730:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2149:Setd1a UTSW 7 127,385,690 (GRCm39) missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4108:Setd1a UTSW 7 127,398,374 (GRCm39) unclassified probably benign
R4227:Setd1a UTSW 7 127,395,819 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4869:Setd1a UTSW 7 127,396,776 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5152:Setd1a UTSW 7 127,383,197 (GRCm39) missense probably benign
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R5527:Setd1a UTSW 7 127,384,801 (GRCm39) missense probably damaging 0.99
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8175:Setd1a UTSW 7 127,395,415 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127,390,669 (GRCm39) missense unknown
R8460:Setd1a UTSW 7 127,383,292 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127,385,332 (GRCm39) missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127,385,590 (GRCm39) missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF014:Setd1a UTSW 7 127,384,518 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAGCTGGAATCGTTACCAGC -3'
(R):5'- ACGGGAATCCAAACTGCTG -3'

Sequencing Primer
(F):5'- GAATCGTTACCAGCGCCATACTTC -3'
(R):5'- ATCCAAACTGCTGTGCTGAG -3'
Posted On 2019-12-04