Incidental Mutation 'RF008:Slc7a6'
ID602991
Institutional Source Beutler Lab
Gene Symbol Slc7a6
Ensembl Gene ENSMUSG00000031904
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 6
SynonymsLAT-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #RF008 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location106168857-106198706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106195398 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 386 (V386I)
Ref Sequence ENSEMBL: ENSMUSP00000034378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034378] [ENSMUST00000211824] [ENSMUST00000212377] [ENSMUST00000212421]
Predicted Effect probably benign
Transcript: ENSMUST00000034378
AA Change: V386I

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034378
Gene: ENSMUSG00000031904
AA Change: V386I

DomainStartEndE-ValueType
Pfam:AA_permease_2 45 467 1.2e-66 PFAM
Pfam:AA_permease 50 471 2.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211824
Predicted Effect probably benign
Transcript: ENSMUST00000212377
Predicted Effect probably benign
Transcript: ENSMUST00000212421
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,765,767 R8H probably benign Het
Abi3bp CCACGACC CCACGACCACGACC 16: 56,627,589 probably benign Het
Acan T G 7: 79,092,400 V515G possibly damaging Het
Acap3 TGG TGGACTGCTGCATCCAGG 4: 155,905,098 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,924 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arid1b GCG GCGACG 17: 4,995,594 probably benign Het
Arid1b CGG CGGAGG 17: 4,995,595 probably benign Het
Begain G GCCGCCC 12: 109,033,437 probably null Het
Cacna1e A G 1: 154,442,136 M1500T probably damaging Het
Casp16-ps C A 17: 23,555,227 probably benign Het
Ccdc174 T C 6: 91,899,366 S395P possibly damaging Het
Ccdc7a T G 8: 128,964,953 Q396H probably damaging Het
Ccdc85c CC CCGGC 12: 108,274,628 probably benign Het
Cemip T C 7: 83,961,635 T704A probably damaging Het
Col7a1 C T 9: 108,964,479 P1370S unknown Het
Cts8 T C 13: 61,249,288 I273V probably benign Het
Cyp2c50 T A 19: 40,089,824 I42N probably damaging Het
Dbt T G 3: 116,548,068 Y439* probably null Het
Dennd1b T A 1: 139,053,397 D116E probably damaging Het
Dkk2 T A 3: 132,178,102 H254Q probably damaging Het
Dpy30 C A 17: 74,315,907 V27F possibly damaging Het
Efhd2 GCCGCC GCCGCCCCCGCC 4: 141,874,758 probably benign Het
Eif4g3 A T 4: 138,175,924 E1020V probably damaging Het
Elmo1 T A 13: 20,274,536 S156T probably benign Het
Fancd2os T C 6: 113,597,920 T42A probably damaging Het
Fbrsl1 TGTGC TGTGCGGGTGTGGGTGC 5: 110,378,118 probably benign Het
Fsip2 T C 2: 82,977,840 V1501A probably benign Het
Gabrb2 A G 11: 42,626,878 Y509C probably damaging Het
Gm8369 GTGT GTGTTTGT 19: 11,511,754 probably null Het
Gpr139 T C 7: 119,144,867 D165G probably benign Het
Grik2 T C 10: 49,244,384 E603G probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Ifitm10 T A 7: 142,328,593 M147L unknown Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Kif1b T A 4: 149,251,738 probably null Het
Krtap28-10 CAGCCA CAGCCATAGCCA 1: 83,042,128 probably benign Het
Krtap28-10 AGCCAC AGCCACCGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 ACCACAGCCACAGCCACCACAGCCACAGCCACCACAGC ACCACAGCCACAGCCACCACAGCCACAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,253 probably benign Het
Krtap28-10 AGCCACCACAGC AGCCACCACAGCCACCGCCACCACAGC 1: 83,042,279 probably benign Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Mical2 T C 7: 112,323,626 Y613H probably damaging Het
Mlf2 C A 6: 124,934,296 H91Q probably benign Het
Nat9 A T 11: 115,183,386 I152N probably damaging Het
Olfr1248 A T 2: 89,617,367 I275N possibly damaging Het
Olfr961 T C 9: 39,647,263 M179T probably benign Het
Pdik1l CACCAC CACCACAACCAC 4: 134,279,511 probably benign Het
Phldb2 T C 16: 45,762,974 S1054G probably damaging Het
Pkhd1l1 TTTT TTTTTTTTTTGTTT 15: 44,558,505 probably benign Het
Plcg2 T A 8: 117,573,524 probably null Het
Prdm16 T A 4: 154,341,995 R444S probably damaging Het
Rgs6 T C 12: 83,063,449 F163L probably damaging Het
Rnaseh2a A T 8: 84,960,058 L154* probably null Het
Rpp38 A G 2: 3,329,035 S277P unknown Het
Setd1a GGTAGTGGT GGTAGTGGTTGTAGTGGT 7: 127,785,314 probably benign Het
Shisa6 CGACAGCAGCAGAG CG 11: 66,525,923 probably benign Het
Slc27a2 T A 2: 126,553,255 L34Q possibly damaging Het
Spry1 C T 3: 37,643,115 T169I possibly damaging Het
Sry TGCTGCTGCTG TGCTGCTGCTGCTG Y: 2,662,826 probably benign Het
Stk24 A T 14: 121,294,760 I275N probably benign Het
Strn TC TCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGGC 17: 78,677,287 probably null Het
Tcp11l2 C A 10: 84,613,524 P451Q probably damaging Het
Tfeb AGC AGCTGC 17: 47,786,102 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,289 probably benign Het
V1ra8 A G 6: 90,203,609 T265A probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Zfp612 C A 8: 110,089,561 H467N probably damaging Het
Zfp777 A T 6: 48,042,048 Y317* probably null Het
Znrd1as CACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCAC 17: 36,965,054 probably benign Het
Other mutations in Slc7a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Slc7a6 APN 8 106179240 missense probably benign 0.01
IGL01149:Slc7a6 APN 8 106179600 missense probably damaging 0.96
IGL02232:Slc7a6 APN 8 106196574 missense possibly damaging 0.87
IGL02972:Slc7a6 APN 8 106179427 missense probably damaging 0.99
IGL03082:Slc7a6 APN 8 106193222 unclassified probably null
IGL03108:Slc7a6 APN 8 106194517 missense probably damaging 0.99
R0062:Slc7a6 UTSW 8 106189631 missense possibly damaging 0.79
R0062:Slc7a6 UTSW 8 106189632 missense probably damaging 0.97
R0325:Slc7a6 UTSW 8 106194517 missense probably damaging 0.99
R1803:Slc7a6 UTSW 8 106192456 missense possibly damaging 0.70
R1928:Slc7a6 UTSW 8 106193488 unclassified probably benign
R5912:Slc7a6 UTSW 8 106179657 missense probably benign
R6317:Slc7a6 UTSW 8 106192467 missense probably damaging 0.98
R6370:Slc7a6 UTSW 8 106195437 missense probably benign 0.44
R7030:Slc7a6 UTSW 8 106195974 missense possibly damaging 0.64
R7944:Slc7a6 UTSW 8 106179607 missense possibly damaging 0.65
R7945:Slc7a6 UTSW 8 106179607 missense possibly damaging 0.65
R8369:Slc7a6 UTSW 8 106193164 missense probably damaging 0.99
R8397:Slc7a6 UTSW 8 106193533 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAGATGTTGCCTTGAAGG -3'
(R):5'- ATGAAATGTGCGTGTTAAGCTCTC -3'

Sequencing Primer
(F):5'- CCTTGAAGGTTACTGAGCCACTG -3'
(R):5'- GGCCACATGGTTAGTTCCAAG -3'
Posted On2019-12-04