Incidental Mutation 'RF008:Olfr961'
ID602994
Institutional Source Beutler Lab
Gene Symbol Olfr961
Ensembl Gene ENSMUSG00000059106
Gene Nameolfactory receptor 961
SynonymsMOR224-5, GA_x6K02T2PVTD-33343617-33344561
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #RF008 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39645085-39649556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39647263 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 179 (M179T)
Ref Sequence ENSEMBL: ENSMUSP00000151840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076548] [ENSMUST00000219295]
Predicted Effect probably benign
Transcript: ENSMUST00000076548
AA Change: M179T

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075863
Gene: ENSMUSG00000059106
AA Change: M179T

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.1e-50 PFAM
Pfam:7tm_1 39 286 4.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219295
AA Change: M179T

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,765,767 R8H probably benign Het
Abi3bp CCACGACC CCACGACCACGACC 16: 56,627,589 probably benign Het
Acan T G 7: 79,092,400 V515G possibly damaging Het
Acap3 TGG TGGACTGCTGCATCCAGG 4: 155,905,098 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,924 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arid1b GCG GCGACG 17: 4,995,594 probably benign Het
Arid1b CGG CGGAGG 17: 4,995,595 probably benign Het
Begain G GCCGCCC 12: 109,033,437 probably null Het
Cacna1e A G 1: 154,442,136 M1500T probably damaging Het
Casp16-ps C A 17: 23,555,227 probably benign Het
Ccdc174 T C 6: 91,899,366 S395P possibly damaging Het
Ccdc7a T G 8: 128,964,953 Q396H probably damaging Het
Ccdc85c CC CCGGC 12: 108,274,628 probably benign Het
Cemip T C 7: 83,961,635 T704A probably damaging Het
Col7a1 C T 9: 108,964,479 P1370S unknown Het
Cts8 T C 13: 61,249,288 I273V probably benign Het
Cyp2c50 T A 19: 40,089,824 I42N probably damaging Het
Dbt T G 3: 116,548,068 Y439* probably null Het
Dennd1b T A 1: 139,053,397 D116E probably damaging Het
Dkk2 T A 3: 132,178,102 H254Q probably damaging Het
Dpy30 C A 17: 74,315,907 V27F possibly damaging Het
Efhd2 GCCGCC GCCGCCCCCGCC 4: 141,874,758 probably benign Het
Eif4g3 A T 4: 138,175,924 E1020V probably damaging Het
Elmo1 T A 13: 20,274,536 S156T probably benign Het
Fancd2os T C 6: 113,597,920 T42A probably damaging Het
Fbrsl1 TGTGC TGTGCGGGTGTGGGTGC 5: 110,378,118 probably benign Het
Fsip2 T C 2: 82,977,840 V1501A probably benign Het
Gabrb2 A G 11: 42,626,878 Y509C probably damaging Het
Gm8369 GTGT GTGTTTGT 19: 11,511,754 probably null Het
Gpr139 T C 7: 119,144,867 D165G probably benign Het
Grik2 T C 10: 49,244,384 E603G probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Ifitm10 T A 7: 142,328,593 M147L unknown Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Kif1b T A 4: 149,251,738 probably null Het
Krtap28-10 CAGCCA CAGCCATAGCCA 1: 83,042,128 probably benign Het
Krtap28-10 AGCCAC AGCCACCGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 ACCACAGCCACAGCCACCACAGCCACAGCCACCACAGC ACCACAGCCACAGCCACCACAGCCACAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,253 probably benign Het
Krtap28-10 AGCCACCACAGC AGCCACCACAGCCACCGCCACCACAGC 1: 83,042,279 probably benign Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Mical2 T C 7: 112,323,626 Y613H probably damaging Het
Mlf2 C A 6: 124,934,296 H91Q probably benign Het
Nat9 A T 11: 115,183,386 I152N probably damaging Het
Olfr1248 A T 2: 89,617,367 I275N possibly damaging Het
Pdik1l CACCAC CACCACAACCAC 4: 134,279,511 probably benign Het
Phldb2 T C 16: 45,762,974 S1054G probably damaging Het
Pkhd1l1 TTTT TTTTTTTTTTGTTT 15: 44,558,505 probably benign Het
Plcg2 T A 8: 117,573,524 probably null Het
Prdm16 T A 4: 154,341,995 R444S probably damaging Het
Rgs6 T C 12: 83,063,449 F163L probably damaging Het
Rnaseh2a A T 8: 84,960,058 L154* probably null Het
Rpp38 A G 2: 3,329,035 S277P unknown Het
Setd1a GGTAGTGGT GGTAGTGGTTGTAGTGGT 7: 127,785,314 probably benign Het
Shisa6 CGACAGCAGCAGAG CG 11: 66,525,923 probably benign Het
Slc27a2 T A 2: 126,553,255 L34Q possibly damaging Het
Slc7a6 G A 8: 106,195,398 V386I probably benign Het
Spry1 C T 3: 37,643,115 T169I possibly damaging Het
Sry TGCTGCTGCTG TGCTGCTGCTGCTG Y: 2,662,826 probably benign Het
Stk24 A T 14: 121,294,760 I275N probably benign Het
Strn TC TCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGGC 17: 78,677,287 probably null Het
Tcp11l2 C A 10: 84,613,524 P451Q probably damaging Het
Tfeb AGC AGCTGC 17: 47,786,102 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,289 probably benign Het
V1ra8 A G 6: 90,203,609 T265A probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Zfp612 C A 8: 110,089,561 H467N probably damaging Het
Zfp777 A T 6: 48,042,048 Y317* probably null Het
Znrd1as CACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCAC 17: 36,965,054 probably benign Het
Other mutations in Olfr961
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Olfr961 APN 9 39647340 missense probably benign 0.19
IGL01792:Olfr961 APN 9 39647659 missense probably benign 0.07
R0344:Olfr961 UTSW 9 39647350 missense probably damaging 1.00
R0503:Olfr961 UTSW 9 39647476 missense probably damaging 1.00
R0525:Olfr961 UTSW 9 39647471 missense probably damaging 1.00
R0531:Olfr961 UTSW 9 39646872 missense probably benign
R1188:Olfr961 UTSW 9 39647476 missense probably damaging 1.00
R1453:Olfr961 UTSW 9 39647163 missense probably benign 0.01
R2970:Olfr961 UTSW 9 39646899 missense probably damaging 1.00
R3883:Olfr961 UTSW 9 39647124 missense probably benign 0.07
R4423:Olfr961 UTSW 9 39647116 missense probably damaging 1.00
R5129:Olfr961 UTSW 9 39647494 missense probably benign 0.03
R6148:Olfr961 UTSW 9 39647259 missense probably damaging 1.00
R6738:Olfr961 UTSW 9 39646661 start gained probably benign
R6778:Olfr961 UTSW 9 39646747 missense probably damaging 1.00
R7194:Olfr961 UTSW 9 39647091 missense probably benign 0.15
R7545:Olfr961 UTSW 9 39647107 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCCTATGACCGCTTTGTTG -3'
(R):5'- GACACACATGATGGCTGTGAGG -3'

Sequencing Primer
(F):5'- ATGACCGCTTTGTTGCCATATG -3'
(R):5'- TGCAGGTGGAGAACGCTCTC -3'
Posted On2019-12-04