Incidental Mutation 'RF008:Trappc9'
ID603010
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Nametrafficking protein particle complex 9
SynonymsTRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF008 (G1)
Quality Score217.468
Status Not validated
Chromosome15
Chromosomal Location72589620-73061204 bp(-) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT to TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT at 72801289 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000170633]
Predicted Effect probably benign
Transcript: ENSMUST00000023276
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089770
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170633
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,765,767 R8H probably benign Het
Abi3bp CCACGACC CCACGACCACGACC 16: 56,627,589 probably benign Het
Acan T G 7: 79,092,400 V515G possibly damaging Het
Acap3 TGG TGGACTGCTGCATCCAGG 4: 155,905,098 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,924 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arid1b GCG GCGACG 17: 4,995,594 probably benign Het
Arid1b CGG CGGAGG 17: 4,995,595 probably benign Het
Begain G GCCGCCC 12: 109,033,437 probably null Het
Cacna1e A G 1: 154,442,136 M1500T probably damaging Het
Casp16-ps C A 17: 23,555,227 probably benign Het
Ccdc174 T C 6: 91,899,366 S395P possibly damaging Het
Ccdc7a T G 8: 128,964,953 Q396H probably damaging Het
Ccdc85c CC CCGGC 12: 108,274,628 probably benign Het
Cemip T C 7: 83,961,635 T704A probably damaging Het
Col7a1 C T 9: 108,964,479 P1370S unknown Het
Cts8 T C 13: 61,249,288 I273V probably benign Het
Cyp2c50 T A 19: 40,089,824 I42N probably damaging Het
Dbt T G 3: 116,548,068 Y439* probably null Het
Dennd1b T A 1: 139,053,397 D116E probably damaging Het
Dkk2 T A 3: 132,178,102 H254Q probably damaging Het
Dpy30 C A 17: 74,315,907 V27F possibly damaging Het
Efhd2 GCCGCC GCCGCCCCCGCC 4: 141,874,758 probably benign Het
Eif4g3 A T 4: 138,175,924 E1020V probably damaging Het
Elmo1 T A 13: 20,274,536 S156T probably benign Het
Fancd2os T C 6: 113,597,920 T42A probably damaging Het
Fbrsl1 TGTGC TGTGCGGGTGTGGGTGC 5: 110,378,118 probably benign Het
Fsip2 T C 2: 82,977,840 V1501A probably benign Het
Gabrb2 A G 11: 42,626,878 Y509C probably damaging Het
Gm8369 GTGT GTGTTTGT 19: 11,511,754 probably null Het
Gpr139 T C 7: 119,144,867 D165G probably benign Het
Grik2 T C 10: 49,244,384 E603G probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Ifitm10 T A 7: 142,328,593 M147L unknown Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Kif1b T A 4: 149,251,738 probably null Het
Krtap28-10 CAGCCA CAGCCATAGCCA 1: 83,042,128 probably benign Het
Krtap28-10 AGCCAC AGCCACCGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 ACCACAGCCACAGCCACCACAGCCACAGCCACCACAGC ACCACAGCCACAGCCACCACAGCCACAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,253 probably benign Het
Krtap28-10 AGCCACCACAGC AGCCACCACAGCCACCGCCACCACAGC 1: 83,042,279 probably benign Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Mical2 T C 7: 112,323,626 Y613H probably damaging Het
Mlf2 C A 6: 124,934,296 H91Q probably benign Het
Nat9 A T 11: 115,183,386 I152N probably damaging Het
Olfr1248 A T 2: 89,617,367 I275N possibly damaging Het
Olfr961 T C 9: 39,647,263 M179T probably benign Het
Pdik1l CACCAC CACCACAACCAC 4: 134,279,511 probably benign Het
Phldb2 T C 16: 45,762,974 S1054G probably damaging Het
Pkhd1l1 TTTT TTTTTTTTTTGTTT 15: 44,558,505 probably benign Het
Plcg2 T A 8: 117,573,524 probably null Het
Prdm16 T A 4: 154,341,995 R444S probably damaging Het
Rgs6 T C 12: 83,063,449 F163L probably damaging Het
Rnaseh2a A T 8: 84,960,058 L154* probably null Het
Rpp38 A G 2: 3,329,035 S277P unknown Het
Setd1a GGTAGTGGT GGTAGTGGTTGTAGTGGT 7: 127,785,314 probably benign Het
Shisa6 CGACAGCAGCAGAG CG 11: 66,525,923 probably benign Het
Slc27a2 T A 2: 126,553,255 L34Q possibly damaging Het
Slc7a6 G A 8: 106,195,398 V386I probably benign Het
Spry1 C T 3: 37,643,115 T169I possibly damaging Het
Sry TGCTGCTGCTG TGCTGCTGCTGCTG Y: 2,662,826 probably benign Het
Stk24 A T 14: 121,294,760 I275N probably benign Het
Strn TC TCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGGC 17: 78,677,287 probably null Het
Tcp11l2 C A 10: 84,613,524 P451Q probably damaging Het
Tfeb AGC AGCTGC 17: 47,786,102 probably benign Het
V1ra8 A G 6: 90,203,609 T265A probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Zfp612 C A 8: 110,089,561 H467N probably damaging Het
Zfp777 A T 6: 48,042,048 Y317* probably null Het
Znrd1as CACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCAC 17: 36,965,054 probably benign Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- CAGGTTGGCAGGGTTTGAAAC -3'
(R):5'- ACTGGAAATGAGTCACCTGGTG -3'

Sequencing Primer
(F):5'- AACATAGGTTCTGCCCCGC -3'
(R):5'- CAGCTGTTTAATGTCAGGC -3'
Posted On2019-12-04