Mutagenetix > Incidental Mutation

Incidental Mutation 'RF008:Trappc9'

603010

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

RF008 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

small insertion (5 aa in frame mutation)

DNA Base Change (assembly)

TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT to TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT at 72801289 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000131997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000170633]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000023276

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000089770

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170633

SMART Domains

Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	820	7.6e-224	PFAM
coiled coil region	857	885	N/A	INTRINSIC
low complexity region	906	929	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.4%
20x: 98.7%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032A03Rik	C	T	9: 50,765,767	R8H	probably benign	Het
Abi3bp	CCACGACC	CCACGACCACGACC	16: 56,627,589		probably benign	Het
Acan	T	G	7: 79,092,400	V515G	possibly damaging	Het
Acap3	TGG	TGGACTGCTGCATCCAGG	4: 155,905,098		probably benign	Het
AI837181	G	GGCT	19: 5,425,238		probably benign	Het
Ankhd1	GGCGGC	GGCGGCAGCGGC	18: 36,560,924		probably benign	Het
Anks1b	G	A	10: 90,033,225	G49D	probably damaging	Het
Arid1b	GCG	GCGACG	17: 4,995,594		probably benign	Het
Arid1b	CGG	CGGAGG	17: 4,995,595		probably benign	Het
Begain	G	GCCGCCC	12: 109,033,437		probably null	Het
Cacna1e	A	G	1: 154,442,136	M1500T	probably damaging	Het
Casp16-ps	C	A	17: 23,555,227		probably benign	Het
Ccdc174	T	C	6: 91,899,366	S395P	possibly damaging	Het
Ccdc7a	T	G	8: 128,964,953	Q396H	probably damaging	Het
Ccdc85c	CC	CCGGC	12: 108,274,628		probably benign	Het
Cemip	T	C	7: 83,961,635	T704A	probably damaging	Het
Col7a1	C	T	9: 108,964,479	P1370S	unknown	Het
Cts8	T	C	13: 61,249,288	I273V	probably benign	Het
Cyp2c50	T	A	19: 40,089,824	I42N	probably damaging	Het
Dbt	T	G	3: 116,548,068	Y439*	probably null	Het
Dennd1b	T	A	1: 139,053,397	D116E	probably damaging	Het
Dkk2	T	A	3: 132,178,102	H254Q	probably damaging	Het
Dpy30	C	A	17: 74,315,907	V27F	possibly damaging	Het
Efhd2	GCCGCC	GCCGCCCCCGCC	4: 141,874,758		probably benign	Het
Eif4g3	A	T	4: 138,175,924	E1020V	probably damaging	Het
Elmo1	T	A	13: 20,274,536	S156T	probably benign	Het
Fancd2os	T	C	6: 113,597,920	T42A	probably damaging	Het
Fbrsl1	TGTGC	TGTGCGGGTGTGGGTGC	5: 110,378,118		probably benign	Het
Fsip2	T	C	2: 82,977,840	V1501A	probably benign	Het
Gabrb2	A	G	11: 42,626,878	Y509C	probably damaging	Het
Gm8369	GTGT	GTGTTTGT	19: 11,511,754		probably null	Het
Gpr139	T	C	7: 119,144,867	D165G	probably benign	Het
Grik2	T	C	10: 49,244,384	E603G	probably damaging	Het
H13	G	A	2: 152,669,669	E30K	probably damaging	Het
Ifitm10	T	A	7: 142,328,593	M147L	unknown	Het
Itpkb	C	T	1: 180,333,322	R338W	probably damaging	Het
Kif1b	T	A	4: 149,251,738		probably null	Het
Krtap28-10	CAGCCA	CAGCCATAGCCA	1: 83,042,128		probably benign	Het
Krtap28-10	AGCCAC	AGCCACCGCCAC	1: 83,042,135		probably benign	Het
Krtap28-10	ACCACAGCCACAGCCACCACAGCCACAGCCACCACAGC	ACCACAGCCACAGCCACCACAGCCACAGCCACCACAGCCACAGCCACCACAGC	1: 83,042,253		probably benign	Het
Krtap28-10	AGCCACCACAGC	AGCCACCACAGCCACCGCCACCACAGC	1: 83,042,279		probably benign	Het
Las1l	AGTGG	AGTGGTGG	X: 95,940,816		probably benign	Het
Mical2	T	C	7: 112,323,626	Y613H	probably damaging	Het
Mlf2	C	A	6: 124,934,296	H91Q	probably benign	Het
Nat9	A	T	11: 115,183,386	I152N	probably damaging	Het
Olfr1248	A	T	2: 89,617,367	I275N	possibly damaging	Het
Olfr961	T	C	9: 39,647,263	M179T	probably benign	Het
Pdik1l	CACCAC	CACCACAACCAC	4: 134,279,511		probably benign	Het
Phldb2	T	C	16: 45,762,974	S1054G	probably damaging	Het
Pkhd1l1	TTTT	TTTTTTTTTTGTTT	15: 44,558,505		probably benign	Het
Plcg2	T	A	8: 117,573,524		probably null	Het
Prdm16	T	A	4: 154,341,995	R444S	probably damaging	Het
Rgs6	T	C	12: 83,063,449	F163L	probably damaging	Het
Rnaseh2a	A	T	8: 84,960,058	L154*	probably null	Het
Rpp38	A	G	2: 3,329,035	S277P	unknown	Het
Setd1a	GGTAGTGGT	GGTAGTGGTTGTAGTGGT	7: 127,785,314		probably benign	Het
Shisa6	CGACAGCAGCAGAG	CG	11: 66,525,923		probably benign	Het
Slc27a2	T	A	2: 126,553,255	L34Q	possibly damaging	Het
Slc7a6	G	A	8: 106,195,398	V386I	probably benign	Het
Spry1	C	T	3: 37,643,115	T169I	possibly damaging	Het
Sry	TGCTGCTGCTG	TGCTGCTGCTGCTG	Y: 2,662,826		probably benign	Het
Stk24	A	T	14: 121,294,760	I275N	probably benign	Het
Strn	TC	TCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGGC	17: 78,677,287		probably null	Het
Tcp11l2	C	A	10: 84,613,524	P451Q	probably damaging	Het
Tfeb	AGC	AGCTGC	17: 47,786,102		probably benign	Het
V1ra8	A	G	6: 90,203,609	T265A	probably benign	Het
Zfp106	CTCCTGGCAGT	CT	2: 120,524,545		probably benign	Het
Zfp612	C	A	8: 110,089,561	H467N	probably damaging	Het
Zfp777	A	T	6: 48,042,048	Y317*	probably null	Het
Znrd1as	CACCACCACCACCACCAC	CACCACCACCACCACCACCACAACCACCACCACCACCAC	17: 36,965,054		probably benign	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
bronto	UTSW	15	73058238	nonsense	probably null
Earl	UTSW	15	72736777	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
R8683:Trappc9	UTSW	15	73012815	missense	probably benign	0.26
R8839:Trappc9	UTSW	15	73058238	nonsense	probably null
R8945:Trappc9	UTSW	15	73058096	missense	probably benign
R9083:Trappc9	UTSW	15	72736777	nonsense	probably null
R9323:Trappc9	UTSW	15	72693582	missense	probably benign	0.41
R9329:Trappc9	UTSW	15	72801353	missense	unknown
R9366:Trappc9	UTSW	15	72937088	missense	probably benign
R9723:Trappc9	UTSW	15	72590114	missense	possibly damaging	0.87
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- CAGGTTGGCAGGGTTTGAAAC -3'
(R):5'- ACTGGAAATGAGTCACCTGGTG -3'

Sequencing Primer
(F):5'- AACATAGGTTCTGCCCCGC -3'
(R):5'- CAGCTGTTTAATGTCAGGC -3'

Posted On

2019-12-04