Incidental Mutation 'RF008:Tfeb'
ID 603016
Institutional Source Beutler Lab
Gene Symbol Tfeb
Ensembl Gene ENSMUSG00000023990
Gene Name transcription factor EB
Synonyms bHLHe35, TFEB, Tcfeb
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF008 (G1)
Quality Score 165.468
Status Not validated
Chromosome 17
Chromosomal Location 47737030-47792419 bp(+) (GRCm38)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) AGC to AGCTGC at 47786102 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024786] [ENSMUST00000086932] [ENSMUST00000113284] [ENSMUST00000113288] [ENSMUST00000125177] [ENSMUST00000126258] [ENSMUST00000130208] [ENSMUST00000137845] [ENSMUST00000141631] [ENSMUST00000146782] [ENSMUST00000159641] [ENSMUST00000160373]
AlphaFold Q9R210
Predicted Effect probably benign
Transcript: ENSMUST00000024786
SMART Domains Protein: ENSMUSP00000024786
Gene: ENSMUSG00000023990

Pfam:MITF_TFEB_C_3_N 63 220 2e-69 PFAM
HLH 299 352 1.44e-15 SMART
Pfam:DUF3371 379 531 1.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086932
SMART Domains Protein: ENSMUSP00000084151
Gene: ENSMUSG00000023990

low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113284
SMART Domains Protein: ENSMUSP00000108909
Gene: ENSMUSG00000023990

low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
Pfam:HLH 235 266 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113288
SMART Domains Protein: ENSMUSP00000108913
Gene: ENSMUSG00000023990

low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125177
SMART Domains Protein: ENSMUSP00000121888
Gene: ENSMUSG00000023990

signal peptide 1 20 N/A INTRINSIC
low complexity region 42 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126258
Predicted Effect probably benign
Transcript: ENSMUST00000130208
SMART Domains Protein: ENSMUSP00000122228
Gene: ENSMUSG00000023990

low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137845
Predicted Effect probably benign
Transcript: ENSMUST00000141631
SMART Domains Protein: ENSMUSP00000118057
Gene: ENSMUSG00000023990

low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146782
SMART Domains Protein: ENSMUSP00000120311
Gene: ENSMUSG00000023990

HLH 99 152 1.44e-15 SMART
Pfam:DUF3371 179 332 1.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159641
SMART Domains Protein: ENSMUSP00000124379
Gene: ENSMUSG00000023990

low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160373
SMART Domains Protein: ENSMUSP00000124708
Gene: ENSMUSG00000023990

low complexity region 7 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,765,767 R8H probably benign Het
Abi3bp CCACGACC CCACGACCACGACC 16: 56,627,589 probably benign Het
Acan T G 7: 79,092,400 V515G possibly damaging Het
Acap3 TGG TGGACTGCTGCATCCAGG 4: 155,905,098 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,924 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arid1b GCG GCGACG 17: 4,995,594 probably benign Het
Arid1b CGG CGGAGG 17: 4,995,595 probably benign Het
Begain G GCCGCCC 12: 109,033,437 probably null Het
Cacna1e A G 1: 154,442,136 M1500T probably damaging Het
Casp16-ps C A 17: 23,555,227 probably benign Het
Ccdc174 T C 6: 91,899,366 S395P possibly damaging Het
Ccdc7a T G 8: 128,964,953 Q396H probably damaging Het
Ccdc85c CC CCGGC 12: 108,274,628 probably benign Het
Cemip T C 7: 83,961,635 T704A probably damaging Het
Col7a1 C T 9: 108,964,479 P1370S unknown Het
Cts8 T C 13: 61,249,288 I273V probably benign Het
Cyp2c50 T A 19: 40,089,824 I42N probably damaging Het
Dbt T G 3: 116,548,068 Y439* probably null Het
Dennd1b T A 1: 139,053,397 D116E probably damaging Het
Dkk2 T A 3: 132,178,102 H254Q probably damaging Het
Dpy30 C A 17: 74,315,907 V27F possibly damaging Het
Efhd2 GCCGCC GCCGCCCCCGCC 4: 141,874,758 probably benign Het
Eif4g3 A T 4: 138,175,924 E1020V probably damaging Het
Elmo1 T A 13: 20,274,536 S156T probably benign Het
Fancd2os T C 6: 113,597,920 T42A probably damaging Het
Fbrsl1 TGTGC TGTGCGGGTGTGGGTGC 5: 110,378,118 probably benign Het
Fsip2 T C 2: 82,977,840 V1501A probably benign Het
Gabrb2 A G 11: 42,626,878 Y509C probably damaging Het
Gm8369 GTGT GTGTTTGT 19: 11,511,754 probably null Het
Gpr139 T C 7: 119,144,867 D165G probably benign Het
Grik2 T C 10: 49,244,384 E603G probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Ifitm10 T A 7: 142,328,593 M147L unknown Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Kif1b T A 4: 149,251,738 probably null Het
Krtap28-10 CAGCCA CAGCCATAGCCA 1: 83,042,128 probably benign Het
Krtap28-10 AGCCAC AGCCACCGCCAC 1: 83,042,135 probably benign Het
Krtap28-10 AGCCACCACAGC AGCCACCACAGCCACCGCCACCACAGC 1: 83,042,279 probably benign Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Mical2 T C 7: 112,323,626 Y613H probably damaging Het
Mlf2 C A 6: 124,934,296 H91Q probably benign Het
Nat9 A T 11: 115,183,386 I152N probably damaging Het
Olfr1248 A T 2: 89,617,367 I275N possibly damaging Het
Olfr961 T C 9: 39,647,263 M179T probably benign Het
Pdik1l CACCAC CACCACAACCAC 4: 134,279,511 probably benign Het
Phldb2 T C 16: 45,762,974 S1054G probably damaging Het
Pkhd1l1 TTTT TTTTTTTTTTGTTT 15: 44,558,505 probably benign Het
Plcg2 T A 8: 117,573,524 probably null Het
Prdm16 T A 4: 154,341,995 R444S probably damaging Het
Rgs6 T C 12: 83,063,449 F163L probably damaging Het
Rnaseh2a A T 8: 84,960,058 L154* probably null Het
Rpp38 A G 2: 3,329,035 S277P unknown Het
Setd1a GGTAGTGGT GGTAGTGGTTGTAGTGGT 7: 127,785,314 probably benign Het
Shisa6 CGACAGCAGCAGAG CG 11: 66,525,923 probably benign Het
Slc27a2 T A 2: 126,553,255 L34Q possibly damaging Het
Slc7a6 G A 8: 106,195,398 V386I probably benign Het
Spry1 C T 3: 37,643,115 T169I possibly damaging Het
Sry TGCTGCTGCTG TGCTGCTGCTGCTG Y: 2,662,826 probably benign Het
Stk24 A T 14: 121,294,760 I275N probably benign Het
Tcp11l2 C A 10: 84,613,524 P451Q probably damaging Het
V1ra8 A G 6: 90,203,609 T265A probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Zfp612 C A 8: 110,089,561 H467N probably damaging Het
Zfp777 A T 6: 48,042,048 Y317* probably null Het
Other mutations in Tfeb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Tfeb APN 17 47791664 missense probably benign 0.10
IGL03248:Tfeb APN 17 47786995 missense probably benign
IGL03280:Tfeb APN 17 47785937 missense probably benign
FR4304:Tfeb UTSW 17 47786094 small insertion probably benign
FR4976:Tfeb UTSW 17 47786094 small insertion probably benign
R0414:Tfeb UTSW 17 47788299 splice site probably null
R1712:Tfeb UTSW 17 47788986 critical splice donor site probably null
R2014:Tfeb UTSW 17 47791559 missense probably damaging 0.97
R2101:Tfeb UTSW 17 47789665 missense probably damaging 1.00
R4283:Tfeb UTSW 17 47789774 missense probably damaging 1.00
R4734:Tfeb UTSW 17 47785862 missense probably benign 0.33
R4785:Tfeb UTSW 17 47788227 splice site probably null
R4948:Tfeb UTSW 17 47785979 missense probably benign 0.00
R5896:Tfeb UTSW 17 47759508 critical splice donor site probably null
R6522:Tfeb UTSW 17 47789702 missense probably damaging 1.00
R6804:Tfeb UTSW 17 47789810 critical splice donor site probably null
R6836:Tfeb UTSW 17 47786198 critical splice donor site probably null
R6923:Tfeb UTSW 17 47786983 missense probably benign 0.11
RF002:Tfeb UTSW 17 47786102 small insertion probably benign
RF003:Tfeb UTSW 17 47788078 missense possibly damaging 0.86
RF006:Tfeb UTSW 17 47786113 small insertion probably benign
RF010:Tfeb UTSW 17 47786094 small insertion probably benign
RF010:Tfeb UTSW 17 47786107 small insertion probably benign
RF018:Tfeb UTSW 17 47786095 small insertion probably benign
RF022:Tfeb UTSW 17 47786094 small insertion probably benign
RF025:Tfeb UTSW 17 47786088 small insertion probably benign
RF028:Tfeb UTSW 17 47786097 small insertion probably benign
RF030:Tfeb UTSW 17 47786111 small insertion probably benign
RF030:Tfeb UTSW 17 47786112 small insertion probably benign
RF030:Tfeb UTSW 17 47786113 small insertion probably benign
RF034:Tfeb UTSW 17 47786097 small insertion probably benign
RF034:Tfeb UTSW 17 47786098 nonsense probably null
RF035:Tfeb UTSW 17 47786111 small insertion probably benign
RF036:Tfeb UTSW 17 47786103 small insertion probably benign
RF038:Tfeb UTSW 17 47786105 small insertion probably benign
RF038:Tfeb UTSW 17 47786112 small insertion probably benign
RF039:Tfeb UTSW 17 47786095 small insertion probably benign
RF039:Tfeb UTSW 17 47786110 nonsense probably null
RF040:Tfeb UTSW 17 47786097 small insertion probably benign
RF040:Tfeb UTSW 17 47786110 small insertion probably benign
RF040:Tfeb UTSW 17 47786111 small insertion probably benign
RF040:Tfeb UTSW 17 47786112 small insertion probably benign
RF041:Tfeb UTSW 17 47786100 small insertion probably benign
RF042:Tfeb UTSW 17 47786097 small insertion probably benign
RF047:Tfeb UTSW 17 47786106 small insertion probably benign
RF047:Tfeb UTSW 17 47786116 small insertion probably benign
RF053:Tfeb UTSW 17 47786114 small insertion probably benign
RF054:Tfeb UTSW 17 47786098 nonsense probably null
RF060:Tfeb UTSW 17 47786106 small insertion probably benign
RF061:Tfeb UTSW 17 47786092 small insertion probably benign
RF062:Tfeb UTSW 17 47786100 small insertion probably benign
Z1177:Tfeb UTSW 17 47786524 nonsense probably null
Z1177:Tfeb UTSW 17 47791644 missense possibly damaging 0.74
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04