Incidental Mutation 'RF009:Cfap65'
ID 603025
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # RF009 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 74944806 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 1477 (R1477L)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably damaging
Transcript: ENSMUST00000094844
AA Change: R1477L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: R1477L

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik ACACACACCCGC AC 4: 136,189,661 (GRCm39) probably null Het
AI182371 A G 2: 34,979,209 (GRCm39) V153A possibly damaging Het
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,693,975 (GRCm39) probably benign Het
Apoc2 C T 7: 19,405,767 (GRCm39) M71I probably benign Het
Arhgap17 CTGTTGTTG CTGTTG 7: 122,886,085 (GRCm39) probably benign Het
Atrn C A 2: 130,748,842 (GRCm39) T121K probably benign Het
Btnl12 T C 16: 37,674,841 (GRCm39) D207G probably benign Het
Ccdc170 C CCAG 10: 4,511,030 (GRCm39) probably benign Het
Cckbr GCA G 7: 105,083,893 (GRCm39) probably null Het
Cdk13 T C 13: 17,978,329 (GRCm39) D303G unknown Het
Chd2 A G 7: 73,169,410 (GRCm39) S37P possibly damaging Het
Chga AGC AGCCGC 12: 102,527,679 (GRCm39) probably benign Het
Csf2rb2 T C 15: 78,176,127 (GRCm39) I259V probably benign Het
Csnk1d A T 11: 120,862,453 (GRCm39) N275K possibly damaging Het
Dmxl1 A C 18: 50,026,461 (GRCm39) R1856S probably damaging Het
Dnah5 T C 15: 28,204,165 (GRCm39) V14A probably benign Het
Edc4 G A 8: 106,615,812 (GRCm39) S729N probably benign Het
Emilin3 T C 2: 160,751,012 (GRCm39) S246G probably benign Het
Epc2 T G 2: 49,422,249 (GRCm39) probably null Het
Exoc6 T A 19: 37,560,068 (GRCm39) F101I probably benign Het
Fam171b GCAGCA GCAGCACCAGCA 2: 83,643,224 (GRCm39) probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,419,435 (GRCm39) probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAGTCACCCACTCCTGGTGT 17: 23,981,135 (GRCm39) probably null Het
Gab3 TTC TTCCTC X: 74,043,598 (GRCm39) probably benign Het
Gab3 CTT CTTATT X: 74,043,630 (GRCm39) probably null Het
Gabpa C A 16: 84,641,224 (GRCm39) Q93K probably benign Het
Gabre GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC X: 71,314,318 (GRCm39) probably benign Het
Gabre GGCTCA GGCTCAAGCTCA X: 71,314,319 (GRCm39) probably benign Het
H2-T3 TCCCGAAGAAC TC 17: 36,500,294 (GRCm39) probably benign Het
Htr5a A G 5: 28,047,859 (GRCm39) D138G probably damaging Het
Ifi207 G A 1: 173,556,558 (GRCm39) P727S probably benign Het
Ifna13 T A 4: 88,562,145 (GRCm39) S160C probably damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Klri2 GGAG GG 6: 129,710,737 (GRCm39) probably null Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 92,925,438 (GRCm39) probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 75,185,014 (GRCm39) probably benign Het
Lrch4 A G 5: 137,635,805 (GRCm39) probably null Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,810,744 (GRCm39) probably null Het
Map1a GCTCCAGC GCTCCAGCCCCAGCTCCAGCTCCAGCTCCACCTCCAGC 2: 121,136,782 (GRCm39) probably benign Het
Mettl25 T C 10: 105,669,100 (GRCm39) probably benign Het
Mex3b A G 7: 82,516,968 (GRCm39) D37G probably damaging Het
Mon1a T A 9: 107,778,433 (GRCm39) V219E probably damaging Het
Myh3 TTACG TTACGTACG 11: 66,977,183 (GRCm39) probably null Het
Myh3 GATTA GATTAATTA 11: 66,977,181 (GRCm39) probably null Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myo5b T A 18: 74,777,070 (GRCm39) C377S probably damaging Het
Nefh ACTTGGCCTCAGCTGGGG ACTTGGCCTCAGCTGGGGCCTTGGCCTCAGCTGGGG 11: 4,890,997 (GRCm39) probably benign Het
Nos1ap T C 1: 170,146,150 (GRCm39) D468G probably damaging Het
Ntn5 T C 7: 45,342,684 (GRCm39) probably null Het
Oog2 T C 4: 143,921,855 (GRCm39) V255A probably benign Het
Or5ac15 T A 16: 58,940,274 (GRCm39) H53L probably damaging Het
Or8b37 A T 9: 37,959,043 (GRCm39) H175L probably damaging Het
Pdgfd C A 9: 6,288,624 (GRCm39) L93M probably damaging Het
Pgls G T 8: 72,045,107 (GRCm39) V83L probably damaging Het
Pigw C A 11: 84,767,987 (GRCm39) Q447H probably damaging Het
Pnma8a TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,695,352 (GRCm39) probably benign Het
Poc1a C A 9: 106,172,417 (GRCm39) L253M possibly damaging Het
Ppl T A 16: 4,915,795 (GRCm39) E589D probably benign Het
Prkar1b A G 5: 139,094,376 (GRCm39) S71P probably benign Het
Prx T C 7: 27,218,385 (GRCm39) F1101S probably damaging Het
Rffl A G 11: 82,736,598 (GRCm39) V26A probably benign Het
Scube3 T A 17: 28,387,371 (GRCm39) L923Q probably damaging Het
Setd2 C T 9: 110,379,779 (GRCm39) P1198L probably damaging Het
Shank2 C A 7: 143,965,308 (GRCm39) A972E possibly damaging Het
Slc10a6 A G 5: 103,756,858 (GRCm39) L302P probably damaging Het
Slc29a3 C T 10: 60,586,340 (GRCm39) G42D probably benign Het
Spart T C 3: 55,035,027 (GRCm39) V471A probably benign Het
Srebf1 T C 11: 60,094,942 (GRCm39) T486A probably benign Het
Sspo T A 6: 48,436,919 (GRCm39) Y1284* probably null Het
Supt20 AGCAGC AGCAGCCGCAGC 3: 54,635,083 (GRCm39) probably benign Het
Tcof1 GCA GCACCA 18: 60,968,815 (GRCm39) probably benign Het
Tff1 CTTCCTG C 17: 31,383,901 (GRCm39) probably benign Het
Tmprss13 ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC ATCTCCAGCAAGGGCACCTCCTCAGGGCTCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC 9: 45,239,762 (GRCm39) probably benign Het
Tnfrsf25 T C 4: 152,204,081 (GRCm39) W341R probably damaging Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,673,136 (GRCm39) probably benign Het
Trav8d-1 T A 14: 53,016,207 (GRCm39) L31Q probably damaging Het
Ttc23 A T 7: 67,375,777 (GRCm39) I452F possibly damaging Het
Uimc1 T C 13: 55,198,598 (GRCm39) E526G possibly damaging Het
Ulbp1 T A 10: 7,397,405 (GRCm39) K233N unknown Het
Usp17ld A T 7: 102,899,495 (GRCm39) V479E probably damaging Het
Utrn T TGTTACCC 10: 12,509,689 (GRCm39) probably null Het
Vmn1r9 C T 6: 57,048,465 (GRCm39) S180L probably benign Het
Wdr97 GAGGAGGA G 15: 76,247,367 (GRCm39) probably null Het
Zfp598 CACC CACCCCTACC 17: 24,899,761 (GRCm39) probably benign Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCATACCGATCAGGGGCTG -3'
(R):5'- TGAGGTCTGCAAACCCTTAG -3'

Sequencing Primer
(F):5'- ATCAGGGGCTGCAGAGTC -3'
(R):5'- GGTCTGCAAACCCTTAGAGAAAG -3'
Posted On 2019-12-04