Incidental Mutation 'RF009:Atrn'
ID603031
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Nameattractin
SynonymsMgca
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF009 (G1)
Quality Score175.009
Status Validated
Chromosome2
Chromosomal Location130906495-131030333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 130906922 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 121 (T121K)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781] [ENSMUST00000146975]
Predicted Effect probably benign
Transcript: ENSMUST00000028781
AA Change: T121K

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: T121K

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146975
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik ACACACACCCGC AC 4: 136,462,350 probably null Het
AI182371 A G 2: 35,089,197 V153A possibly damaging Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,560,922 probably benign Het
Apoc2 C T 7: 19,671,842 M71I probably benign Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Ccdc170 C CCAG 10: 4,561,030 probably benign Het
Cckbr GCA G 7: 105,434,686 probably null Het
Cdk13 T C 13: 17,803,744 D303G unknown Het
Cfap65 C A 1: 74,905,647 R1477L probably damaging Het
Chd2 A G 7: 73,519,662 S37P possibly damaging Het
Chga AGC AGCCGC 12: 102,561,420 probably benign Het
Csf2rb2 T C 15: 78,291,927 I259V probably benign Het
Csnk1d A T 11: 120,971,627 N275K possibly damaging Het
Dmxl1 A C 18: 49,893,394 R1856S probably damaging Het
Dnah5 T C 15: 28,204,019 V14A probably benign Het
Edc4 G A 8: 105,889,180 S729N probably benign Het
Emilin3 T C 2: 160,909,092 S246G probably benign Het
Epc2 T G 2: 49,532,237 probably null Het
Exoc6 T A 19: 37,571,620 F101I probably benign Het
Fam171b GCAGCA GCAGCACCAGCA 2: 83,812,880 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAGTCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Gab3 TTC TTCCTC X: 74,999,992 probably benign Het
Gab3 CTT CTTATT X: 75,000,024 probably null Het
Gabpa C A 16: 84,844,336 Q93K probably benign Het
Gabre GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC X: 72,270,712 probably benign Het
Gabre GGCTCA GGCTCAAGCTCA X: 72,270,713 probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,167 probably null Het
Gm36028 T C 16: 37,854,479 D207G probably benign Het
H2-T3 TCCCGAAGAAC TC 17: 36,189,402 probably benign Het
Htr5a A G 5: 27,842,861 D138G probably damaging Het
Ifi207 G A 1: 173,728,992 P727S probably benign Het
Ifna13 T A 4: 88,643,908 S160C probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Klri2 GGAG GG 6: 129,733,774 probably null Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lrch4 A G 5: 137,637,543 probably null Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Map1a GCTCCAGC GCTCCAGCCCCAGCTCCAGCTCCAGCTCCACCTCCAGC 2: 121,306,301 probably benign Het
Mettl25 T C 10: 105,833,239 probably benign Het
Mex3b A G 7: 82,867,760 D37G probably damaging Het
Mon1a T A 9: 107,901,234 V219E probably damaging Het
Myh3 GATTA GATTAATTA 11: 67,086,355 probably null Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 TTACG TTACGTACG 11: 67,086,357 probably null Het
Myo5b T A 18: 74,643,999 C377S probably damaging Het
Nefh ACTTGGCCTCAGCTGGGG ACTTGGCCTCAGCTGGGGCCTTGGCCTCAGCTGGGG 11: 4,940,997 probably benign Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Ntn5 T C 7: 45,693,260 probably null Het
Olfr194 T A 16: 59,119,911 H53L probably damaging Het
Olfr884 A T 9: 38,047,747 H175L probably damaging Het
Oog2 T C 4: 144,195,285 V255A probably benign Het
Pdgfd C A 9: 6,288,624 L93M probably damaging Het
Pgls G T 8: 71,592,463 V83L probably damaging Het
Pigw C A 11: 84,877,161 Q447H probably damaging Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Poc1a C A 9: 106,295,218 L253M possibly damaging Het
Ppl T A 16: 5,097,931 E589D probably benign Het
Prkar1b A G 5: 139,108,621 S71P probably benign Het
Prx T C 7: 27,518,960 F1101S probably damaging Het
Rffl A G 11: 82,845,772 V26A probably benign Het
Scube3 T A 17: 28,168,397 L923Q probably damaging Het
Setd2 C T 9: 110,550,711 P1198L probably damaging Het
Shank2 C A 7: 144,411,571 A972E possibly damaging Het
Slc10a6 A G 5: 103,608,992 L302P probably damaging Het
Slc29a3 C T 10: 60,750,561 G42D probably benign Het
Spg20 T C 3: 55,127,606 V471A probably benign Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Sspo T A 6: 48,459,985 Y1284* probably null Het
Supt20 AGCAGC AGCAGCCGCAGC 3: 54,727,662 probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tff1 CTTCCTG C 17: 31,164,927 probably benign Het
Tmprss13 ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC ATCTCCAGCAAGGGCACCTCCTCAGGGCTCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC 9: 45,328,464 probably benign Het
Tnfrsf25 T C 4: 152,119,624 W341R probably damaging Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,287 probably benign Het
Trav8d-1 T A 14: 52,778,750 L31Q probably damaging Het
Ttc23 A T 7: 67,726,029 I452F possibly damaging Het
Uimc1 T C 13: 55,050,785 E526G possibly damaging Het
Ulbp1 T A 10: 7,447,405 K233N unknown Het
Usp17ld A T 7: 103,250,288 V479E probably damaging Het
Utrn T TGTTACCC 10: 12,633,945 probably null Het
Vmn1r9 C T 6: 57,071,480 S180L probably benign Het
Zfp598 CACC CACCCCTACC 17: 24,680,787 probably benign Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130958079 missense probably damaging 1.00
IGL00571:Atrn APN 2 130995048 missense probably damaging 1.00
IGL01092:Atrn APN 2 130947636 nonsense probably null
IGL01572:Atrn APN 2 131002795 missense probably damaging 1.00
IGL01924:Atrn APN 2 130935565 missense probably damaging 1.00
IGL02116:Atrn APN 2 130958089 missense probably damaging 1.00
IGL02372:Atrn APN 2 131002754 splice site probably benign
IGL02390:Atrn APN 2 131020977 missense possibly damaging 0.82
IGL02548:Atrn APN 2 130972282 missense probably damaging 1.00
IGL02749:Atrn APN 2 130970144 nonsense probably null
IGL02749:Atrn APN 2 130947734 splice site probably benign
BB010:Atrn UTSW 2 130995066 missense probably damaging 1.00
BB020:Atrn UTSW 2 130995066 missense probably damaging 1.00
R0026:Atrn UTSW 2 130957920 missense probably damaging 1.00
R0403:Atrn UTSW 2 130906859 missense probably damaging 1.00
R0479:Atrn UTSW 2 130999165 nonsense probably null
R0544:Atrn UTSW 2 130986826 missense probably damaging 1.00
R0570:Atrn UTSW 2 130980134 missense probably benign 0.01
R0606:Atrn UTSW 2 130906856 missense possibly damaging 0.90
R0617:Atrn UTSW 2 130995085 critical splice donor site probably null
R0658:Atrn UTSW 2 130970227 critical splice donor site probably null
R1108:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1112:Atrn UTSW 2 130999161 missense probably benign 0.04
R1219:Atrn UTSW 2 131021007 missense possibly damaging 0.90
R1422:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1524:Atrn UTSW 2 130957080 missense probably benign 0.15
R1653:Atrn UTSW 2 130935624 missense probably benign
R1795:Atrn UTSW 2 130972288 missense probably benign
R1807:Atrn UTSW 2 130982772 missense possibly damaging 0.94
R1920:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1921:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1935:Atrn UTSW 2 130958035 missense probably damaging 1.00
R1982:Atrn UTSW 2 130970222 missense probably benign
R2000:Atrn UTSW 2 130935588 missense probably damaging 1.00
R2143:Atrn UTSW 2 130957996 missense probably benign 0.03
R2336:Atrn UTSW 2 130957954 missense probably damaging 1.00
R2679:Atrn UTSW 2 130961675 critical splice donor site probably null
R3426:Atrn UTSW 2 131020956 missense probably benign 0.06
R3909:Atrn UTSW 2 130994207 missense probably damaging 1.00
R4077:Atrn UTSW 2 130964930 critical splice donor site probably null
R4162:Atrn UTSW 2 130994228 splice site probably benign
R4195:Atrn UTSW 2 130933412 missense probably damaging 1.00
R4364:Atrn UTSW 2 130970208 missense probably benign 0.39
R4465:Atrn UTSW 2 130960468 missense probably benign 0.08
R4510:Atrn UTSW 2 130935577 nonsense probably null
R4511:Atrn UTSW 2 130935577 nonsense probably null
R4527:Atrn UTSW 2 130973504 missense probably benign 0.10
R4586:Atrn UTSW 2 130982042 missense probably damaging 1.00
R4592:Atrn UTSW 2 130999130 intron probably benign
R4658:Atrn UTSW 2 130933429 missense probably damaging 1.00
R4735:Atrn UTSW 2 131020990 missense probably benign 0.06
R4960:Atrn UTSW 2 130995047 nonsense probably null
R4999:Atrn UTSW 2 130975954 missense probably damaging 1.00
R5066:Atrn UTSW 2 130994193 missense possibly damaging 0.60
R5080:Atrn UTSW 2 130970124 missense possibly damaging 0.95
R5141:Atrn UTSW 2 130999130 intron probably benign
R5256:Atrn UTSW 2 130946019 missense probably benign 0.39
R5494:Atrn UTSW 2 131023075 missense probably damaging 1.00
R5678:Atrn UTSW 2 130970016 missense probably damaging 0.96
R5752:Atrn UTSW 2 130906544 unclassified probably benign
R5931:Atrn UTSW 2 130933436 missense possibly damaging 0.56
R6023:Atrn UTSW 2 131020980 missense probably benign 0.25
R6176:Atrn UTSW 2 130946091 missense probably benign 0.31
R6377:Atrn UTSW 2 130979969 missense probably damaging 1.00
R6433:Atrn UTSW 2 131023027 missense probably damaging 1.00
R7226:Atrn UTSW 2 130986744 missense probably damaging 0.99
R7402:Atrn UTSW 2 130947600 missense probably damaging 1.00
R7541:Atrn UTSW 2 130961571 missense possibly damaging 0.46
R7587:Atrn UTSW 2 130980114 missense probably damaging 1.00
R7872:Atrn UTSW 2 130970227 critical splice donor site probably null
R7910:Atrn UTSW 2 130964887 missense probably benign 0.04
R7913:Atrn UTSW 2 130970211 missense probably damaging 1.00
R7933:Atrn UTSW 2 130995066 missense probably damaging 1.00
R8044:Atrn UTSW 2 130935529 missense probably damaging 1.00
R8079:Atrn UTSW 2 131013641 missense probably null 1.00
R8093:Atrn UTSW 2 130975988 missense probably benign 0.00
R8203:Atrn UTSW 2 130960549 missense probably benign 0.00
R8234:Atrn UTSW 2 131023000 critical splice acceptor site probably null
X0024:Atrn UTSW 2 130958139 missense probably damaging 1.00
Z1088:Atrn UTSW 2 130973399 missense probably benign
Z1176:Atrn UTSW 2 130946193 missense probably benign 0.27
Z1177:Atrn UTSW 2 130946042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGATATGGACCCGCCG -3'
(R):5'- CTCCAGGAGGCAAGCCATC -3'

Sequencing Primer
(F):5'- TCAGCCCCAGGAAGATGGTG -3'
(R):5'- TCATCAAACACAGTGGGGC -3'
Posted On2019-12-04