Incidental Mutation 'RF009:Prx'
ID603049
Institutional Source Beutler Lab
Gene Symbol Prx
Ensembl Gene ENSMUSG00000053198
Gene Nameperiaxin
SynonymsL-Periaxin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF009 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27499324-27520214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27518960 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1101 (F1101S)
Ref Sequence ENSEMBL: ENSMUSP00000066110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065487] [ENSMUST00000098644] [ENSMUST00000108353] [ENSMUST00000108355] [ENSMUST00000125990]
Predicted Effect probably damaging
Transcript: ENSMUST00000065487
AA Change: F1101S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066110
Gene: ENSMUSG00000053198
AA Change: F1101S

DomainStartEndE-ValueType
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 9.05e-5 PROSPERO
internal_repeat_2 317 428 7.28e-6 PROSPERO
internal_repeat_1 321 508 8.09e-9 PROSPERO
internal_repeat_1 503 779 8.09e-9 PROSPERO
internal_repeat_2 840 974 7.28e-6 PROSPERO
internal_repeat_3 1176 1268 9.05e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098644
AA Change: F1101S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096241
Gene: ENSMUSG00000053198
AA Change: F1101S

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 5.13e-5 PROSPERO
internal_repeat_2 317 428 3.79e-6 PROSPERO
internal_repeat_1 321 508 3.34e-9 PROSPERO
internal_repeat_1 503 779 3.34e-9 PROSPERO
internal_repeat_2 840 974 3.79e-6 PROSPERO
internal_repeat_3 1176 1268 5.13e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108353
SMART Domains Protein: ENSMUSP00000103990
Gene: ENSMUSG00000040424

DomainStartEndE-ValueType
S_TKc 11 347 9.31e-74 SMART
low complexity region 396 410 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108355
SMART Domains Protein: ENSMUSP00000103992
Gene: ENSMUSG00000053198

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125990
AA Change: F962S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display locomotor problems as well as difficulty eating and breathing. Demyelination of peripheral nerves develops with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik ACACACACCCGC AC 4: 136,462,350 probably null Het
AI182371 A G 2: 35,089,197 V153A possibly damaging Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,560,922 probably benign Het
Apoc2 C T 7: 19,671,842 M71I probably benign Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Atrn C A 2: 130,906,922 T121K probably benign Het
Ccdc170 C CCAG 10: 4,561,030 probably benign Het
Cckbr GCA G 7: 105,434,686 probably null Het
Cdk13 T C 13: 17,803,744 D303G unknown Het
Cfap65 C A 1: 74,905,647 R1477L probably damaging Het
Chd2 A G 7: 73,519,662 S37P possibly damaging Het
Chga AGC AGCCGC 12: 102,561,420 probably benign Het
Csf2rb2 T C 15: 78,291,927 I259V probably benign Het
Csnk1d A T 11: 120,971,627 N275K possibly damaging Het
Dmxl1 A C 18: 49,893,394 R1856S probably damaging Het
Dnah5 T C 15: 28,204,019 V14A probably benign Het
Edc4 G A 8: 105,889,180 S729N probably benign Het
Emilin3 T C 2: 160,909,092 S246G probably benign Het
Epc2 T G 2: 49,532,237 probably null Het
Exoc6 T A 19: 37,571,620 F101I probably benign Het
Fam171b GCAGCA GCAGCACCAGCA 2: 83,812,880 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAGTCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Gab3 CTT CTTATT X: 75,000,024 probably null Het
Gab3 TTC TTCCTC X: 74,999,992 probably benign Het
Gabpa C A 16: 84,844,336 Q93K probably benign Het
Gabre GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC X: 72,270,712 probably benign Het
Gabre GGCTCA GGCTCAAGCTCA X: 72,270,713 probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,167 probably null Het
Gm36028 T C 16: 37,854,479 D207G probably benign Het
H2-T3 TCCCGAAGAAC TC 17: 36,189,402 probably benign Het
Htr5a A G 5: 27,842,861 D138G probably damaging Het
Ifi207 G A 1: 173,728,992 P727S probably benign Het
Ifna13 T A 4: 88,643,908 S160C probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Klri2 GGAG GG 6: 129,733,774 probably null Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lrch4 A G 5: 137,637,543 probably null Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Map1a GCTCCAGC GCTCCAGCCCCAGCTCCAGCTCCAGCTCCACCTCCAGC 2: 121,306,301 probably benign Het
Mettl25 T C 10: 105,833,239 probably benign Het
Mex3b A G 7: 82,867,760 D37G probably damaging Het
Mon1a T A 9: 107,901,234 V219E probably damaging Het
Myh3 GATTA GATTAATTA 11: 67,086,355 probably null Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 TTACG TTACGTACG 11: 67,086,357 probably null Het
Myo5b T A 18: 74,643,999 C377S probably damaging Het
Nefh ACTTGGCCTCAGCTGGGG ACTTGGCCTCAGCTGGGGCCTTGGCCTCAGCTGGGG 11: 4,940,997 probably benign Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Ntn5 T C 7: 45,693,260 probably null Het
Olfr194 T A 16: 59,119,911 H53L probably damaging Het
Olfr884 A T 9: 38,047,747 H175L probably damaging Het
Oog2 T C 4: 144,195,285 V255A probably benign Het
Pdgfd C A 9: 6,288,624 L93M probably damaging Het
Pgls G T 8: 71,592,463 V83L probably damaging Het
Pigw C A 11: 84,877,161 Q447H probably damaging Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Poc1a C A 9: 106,295,218 L253M possibly damaging Het
Ppl T A 16: 5,097,931 E589D probably benign Het
Prkar1b A G 5: 139,108,621 S71P probably benign Het
Rffl A G 11: 82,845,772 V26A probably benign Het
Scube3 T A 17: 28,168,397 L923Q probably damaging Het
Setd2 C T 9: 110,550,711 P1198L probably damaging Het
Shank2 C A 7: 144,411,571 A972E possibly damaging Het
Slc10a6 A G 5: 103,608,992 L302P probably damaging Het
Slc29a3 C T 10: 60,750,561 G42D probably benign Het
Spg20 T C 3: 55,127,606 V471A probably benign Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Sspo T A 6: 48,459,985 Y1284* probably null Het
Supt20 AGCAGC AGCAGCCGCAGC 3: 54,727,662 probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tff1 CTTCCTG C 17: 31,164,927 probably benign Het
Tmprss13 ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC ATCTCCAGCAAGGGCACCTCCTCAGGGCTCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC 9: 45,328,464 probably benign Het
Tnfrsf25 T C 4: 152,119,624 W341R probably damaging Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,287 probably benign Het
Trav8d-1 T A 14: 52,778,750 L31Q probably damaging Het
Ttc23 A T 7: 67,726,029 I452F possibly damaging Het
Uimc1 T C 13: 55,050,785 E526G possibly damaging Het
Ulbp1 T A 10: 7,447,405 K233N unknown Het
Usp17ld A T 7: 103,250,288 V479E probably damaging Het
Utrn T TGTTACCC 10: 12,633,945 probably null Het
Vmn1r9 C T 6: 57,071,480 S180L probably benign Het
Zfp598 CACC CACCCCTACC 17: 24,680,787 probably benign Het
Other mutations in Prx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Prx APN 7 27519419 missense probably benign 0.12
IGL01702:Prx APN 7 27519787 missense probably benign 0.00
IGL02012:Prx APN 7 27517901 missense probably damaging 1.00
IGL02214:Prx APN 7 27518912 missense probably damaging 1.00
IGL02498:Prx APN 7 27518072 missense probably damaging 1.00
IGL03029:Prx APN 7 27508061 nonsense probably null
R0522:Prx UTSW 7 27518195 missense probably damaging 0.99
R0655:Prx UTSW 7 27517421 missense probably damaging 1.00
R0904:Prx UTSW 7 27518294 missense probably damaging 1.00
R1161:Prx UTSW 7 27519677 missense probably damaging 1.00
R1170:Prx UTSW 7 27518007 nonsense probably null
R1270:Prx UTSW 7 27518930 missense probably damaging 0.96
R1470:Prx UTSW 7 27517601 missense probably benign 0.19
R1470:Prx UTSW 7 27517601 missense probably benign 0.19
R1536:Prx UTSW 7 27517258 missense probably damaging 0.99
R1721:Prx UTSW 7 27517523 missense probably benign 0.19
R1815:Prx UTSW 7 27516665 missense probably damaging 1.00
R1848:Prx UTSW 7 27518888 missense possibly damaging 0.70
R1894:Prx UTSW 7 27519110 missense possibly damaging 0.68
R2179:Prx UTSW 7 27517985 missense probably benign
R2207:Prx UTSW 7 27516788 missense probably damaging 1.00
R2312:Prx UTSW 7 27516626 missense possibly damaging 0.87
R2356:Prx UTSW 7 27507859 start gained probably benign
R2519:Prx UTSW 7 27518243 missense probably benign 0.43
R2912:Prx UTSW 7 27516229 missense probably damaging 1.00
R4717:Prx UTSW 7 27516727 missense probably benign 0.07
R4868:Prx UTSW 7 27517579 missense probably benign 0.01
R5153:Prx UTSW 7 27518476 missense probably damaging 1.00
R5418:Prx UTSW 7 27517274 missense probably damaging 0.99
R5653:Prx UTSW 7 27517604 missense probably damaging 1.00
R5895:Prx UTSW 7 27515284 missense probably damaging 1.00
R6022:Prx UTSW 7 27517573 missense probably damaging 1.00
R6112:Prx UTSW 7 27516548 missense probably damaging 1.00
R6223:Prx UTSW 7 27516836 missense probably damaging 1.00
R6560:Prx UTSW 7 27515321 missense probably damaging 1.00
R6888:Prx UTSW 7 27519634 missense possibly damaging 0.73
R7530:Prx UTSW 7 27507972 missense probably damaging 1.00
R7854:Prx UTSW 7 27516641 missense probably damaging 1.00
R8258:Prx UTSW 7 27519383 missense probably damaging 1.00
R8259:Prx UTSW 7 27519383 missense probably damaging 1.00
X0028:Prx UTSW 7 27517733 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAAGATCCCTGCGGTGGAATTG -3'
(R):5'- ACTCTTGGCTGCTTCACCAG -3'

Sequencing Primer
(F):5'- TGGAATTGGTCACACCGG -3'
(R):5'- GCCCCACATCCAGCTCTAG -3'
Posted On2019-12-04