Incidental Mutation 'RF009:Ttc23'
ID603050
Institutional Source Beutler Lab
Gene Symbol Ttc23
Ensembl Gene ENSMUSG00000030555
Gene Nametetratricopeptide repeat domain 23
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #RF009 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location67647410-67762912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67726029 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 452 (I452F)
Ref Sequence ENSEMBL: ENSMUSP00000032774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032774] [ENSMUST00000051389] [ENSMUST00000074233] [ENSMUST00000107470] [ENSMUST00000107471] [ENSMUST00000208231]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032774
AA Change: I452F

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032774
Gene: ENSMUSG00000030555
AA Change: I452F

DomainStartEndE-ValueType
Blast:TPR 45 78 5e-10 BLAST
SCOP:d1a17__ 50 214 6e-8 SMART
Blast:TPR 87 121 3e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Blast:TPR 186 219 1e-6 BLAST
low complexity region 310 323 N/A INTRINSIC
Blast:TPR 398 431 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000051389
SMART Domains Protein: ENSMUSP00000050987
Gene: ENSMUSG00000030554

DomainStartEndE-ValueType
Pfam:Filament 10 321 2.7e-38 PFAM
low complexity region 1248 1257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074233
SMART Domains Protein: ENSMUSP00000073855
Gene: ENSMUSG00000030554

DomainStartEndE-ValueType
Filament 10 321 6.4e-38 SMART
internal_repeat_1 1089 1185 3.03e-7 PROSPERO
internal_repeat_1 1351 1454 3.03e-7 PROSPERO
low complexity region 1550 1559 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107470
AA Change: I410F

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103094
Gene: ENSMUSG00000030555
AA Change: I410F

DomainStartEndE-ValueType
Blast:TPR 45 78 4e-10 BLAST
Blast:TPR 87 121 2e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Pfam:TPR_12 185 257 5.9e-10 PFAM
low complexity region 268 281 N/A INTRINSIC
Blast:TPR 356 389 5e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000107471
AA Change: I410F

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103095
Gene: ENSMUSG00000030555
AA Change: I410F

DomainStartEndE-ValueType
Blast:TPR 45 78 4e-10 BLAST
Blast:TPR 87 121 2e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Pfam:TPR_12 185 257 5.9e-10 PFAM
low complexity region 268 281 N/A INTRINSIC
Blast:TPR 356 389 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000208231
Predicted Effect probably benign
Transcript: ENSMUST00000208764
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik ACACACACCCGC AC 4: 136,462,350 probably null Het
AI182371 A G 2: 35,089,197 V153A possibly damaging Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,560,922 probably benign Het
Apoc2 C T 7: 19,671,842 M71I probably benign Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Atrn C A 2: 130,906,922 T121K probably benign Het
Ccdc170 C CCAG 10: 4,561,030 probably benign Het
Cckbr GCA G 7: 105,434,686 probably null Het
Cdk13 T C 13: 17,803,744 D303G unknown Het
Cfap65 C A 1: 74,905,647 R1477L probably damaging Het
Chd2 A G 7: 73,519,662 S37P possibly damaging Het
Chga AGC AGCCGC 12: 102,561,420 probably benign Het
Csf2rb2 T C 15: 78,291,927 I259V probably benign Het
Csnk1d A T 11: 120,971,627 N275K possibly damaging Het
Dmxl1 A C 18: 49,893,394 R1856S probably damaging Het
Dnah5 T C 15: 28,204,019 V14A probably benign Het
Edc4 G A 8: 105,889,180 S729N probably benign Het
Emilin3 T C 2: 160,909,092 S246G probably benign Het
Epc2 T G 2: 49,532,237 probably null Het
Exoc6 T A 19: 37,571,620 F101I probably benign Het
Fam171b GCAGCA GCAGCACCAGCA 2: 83,812,880 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAGTCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Gab3 TTC TTCCTC X: 74,999,992 probably benign Het
Gab3 CTT CTTATT X: 75,000,024 probably null Het
Gabpa C A 16: 84,844,336 Q93K probably benign Het
Gabre GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC X: 72,270,712 probably benign Het
Gabre GGCTCA GGCTCAAGCTCA X: 72,270,713 probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,167 probably null Het
Gm36028 T C 16: 37,854,479 D207G probably benign Het
H2-T3 TCCCGAAGAAC TC 17: 36,189,402 probably benign Het
Htr5a A G 5: 27,842,861 D138G probably damaging Het
Ifi207 G A 1: 173,728,992 P727S probably benign Het
Ifna13 T A 4: 88,643,908 S160C probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Klri2 GGAG GG 6: 129,733,774 probably null Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lrch4 A G 5: 137,637,543 probably null Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Map1a GCTCCAGC GCTCCAGCCCCAGCTCCAGCTCCAGCTCCACCTCCAGC 2: 121,306,301 probably benign Het
Mettl25 T C 10: 105,833,239 probably benign Het
Mex3b A G 7: 82,867,760 D37G probably damaging Het
Mon1a T A 9: 107,901,234 V219E probably damaging Het
Myh3 GATTA GATTAATTA 11: 67,086,355 probably null Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 TTACG TTACGTACG 11: 67,086,357 probably null Het
Myo5b T A 18: 74,643,999 C377S probably damaging Het
Nefh ACTTGGCCTCAGCTGGGG ACTTGGCCTCAGCTGGGGCCTTGGCCTCAGCTGGGG 11: 4,940,997 probably benign Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Ntn5 T C 7: 45,693,260 probably null Het
Olfr194 T A 16: 59,119,911 H53L probably damaging Het
Olfr884 A T 9: 38,047,747 H175L probably damaging Het
Oog2 T C 4: 144,195,285 V255A probably benign Het
Pdgfd C A 9: 6,288,624 L93M probably damaging Het
Pgls G T 8: 71,592,463 V83L probably damaging Het
Pigw C A 11: 84,877,161 Q447H probably damaging Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Poc1a C A 9: 106,295,218 L253M possibly damaging Het
Ppl T A 16: 5,097,931 E589D probably benign Het
Prkar1b A G 5: 139,108,621 S71P probably benign Het
Prx T C 7: 27,518,960 F1101S probably damaging Het
Rffl A G 11: 82,845,772 V26A probably benign Het
Scube3 T A 17: 28,168,397 L923Q probably damaging Het
Setd2 C T 9: 110,550,711 P1198L probably damaging Het
Shank2 C A 7: 144,411,571 A972E possibly damaging Het
Slc10a6 A G 5: 103,608,992 L302P probably damaging Het
Slc29a3 C T 10: 60,750,561 G42D probably benign Het
Spg20 T C 3: 55,127,606 V471A probably benign Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Sspo T A 6: 48,459,985 Y1284* probably null Het
Supt20 AGCAGC AGCAGCCGCAGC 3: 54,727,662 probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tff1 CTTCCTG C 17: 31,164,927 probably benign Het
Tmprss13 ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC ATCTCCAGCAAGGGCACCTCCTCAGGGCTCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC 9: 45,328,464 probably benign Het
Tnfrsf25 T C 4: 152,119,624 W341R probably damaging Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,287 probably benign Het
Trav8d-1 T A 14: 52,778,750 L31Q probably damaging Het
Uimc1 T C 13: 55,050,785 E526G possibly damaging Het
Ulbp1 T A 10: 7,447,405 K233N unknown Het
Usp17ld A T 7: 103,250,288 V479E probably damaging Het
Utrn T TGTTACCC 10: 12,633,945 probably null Het
Vmn1r9 C T 6: 57,071,480 S180L probably benign Het
Zfp598 CACC CACCCCTACC 17: 24,680,787 probably benign Het
Other mutations in Ttc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02852:Ttc23 APN 7 67667155 unclassified probably benign
IGL03257:Ttc23 APN 7 67711378 missense probably damaging 1.00
IGL03365:Ttc23 APN 7 67662337 utr 5 prime probably benign
IGL03404:Ttc23 APN 7 67678897 missense probably damaging 0.99
F5770:Ttc23 UTSW 7 67709315 splice site probably benign
PIT4445001:Ttc23 UTSW 7 67667213 missense probably damaging 1.00
PIT4791001:Ttc23 UTSW 7 67662387 missense probably damaging 1.00
R0295:Ttc23 UTSW 7 67669852 unclassified probably benign
R0316:Ttc23 UTSW 7 67679073 critical splice donor site probably null
R0336:Ttc23 UTSW 7 67662483 missense probably benign 0.01
R1456:Ttc23 UTSW 7 67667154 unclassified probably benign
R1543:Ttc23 UTSW 7 67678995 missense probably benign 0.01
R1662:Ttc23 UTSW 7 67725321 splice site probably null
R1708:Ttc23 UTSW 7 67667176 missense probably damaging 0.99
R1857:Ttc23 UTSW 7 67679073 critical splice donor site probably null
R2292:Ttc23 UTSW 7 67669787 missense probably benign 0.08
R4471:Ttc23 UTSW 7 67670156 missense probably benign 0.37
R6036:Ttc23 UTSW 7 67711366 missense possibly damaging 0.85
R6036:Ttc23 UTSW 7 67711366 missense possibly damaging 0.85
R6841:Ttc23 UTSW 7 67669728 missense possibly damaging 0.91
R7690:Ttc23 UTSW 7 67670170 missense possibly damaging 0.76
R8305:Ttc23 UTSW 7 67662387 missense probably damaging 0.99
X0021:Ttc23 UTSW 7 67670131 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTCATTCCACGGATGACC -3'
(R):5'- TTCACCTTCGAGCTGGAGAG -3'

Sequencing Primer
(F):5'- GGATGACCTACCTAAGACCTGATTTG -3'
(R):5'- GAGGTTTGTTCAGCATCCTACAAGC -3'
Posted On2019-12-04