Incidental Mutation 'RF009:Cckbr'
ID603053
Institutional Source Beutler Lab
Gene Symbol Cckbr
Ensembl Gene ENSMUSG00000030898
Gene Namecholecystokinin B receptor
SynonymsCCK2/gastrin, CCK2R, CCKR-2, CCK-B/gastrin receptor
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #RF009 (G1)
Quality Score104.457
Status Not validated
Chromosome7
Chromosomal Location105425731-105470898 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCA to G at 105434686 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033189] [ENSMUST00000181339]
Predicted Effect probably null
Transcript: ENSMUST00000033189
SMART Domains Protein: ENSMUSP00000033189
Gene: ENSMUSG00000030898

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:7tm_1 71 396 4.1e-59 PFAM
low complexity region 409 434 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000181339
SMART Domains Protein: ENSMUSP00000138052
Gene: ENSMUSG00000030898

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:7tm_1 71 301 3.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a multipass transmembrane receptor protein expressed in the central nervous system and gastrointestinal tract. Cholecystokinin and gastrin bind to the encoded protein to stimulate gastric acid secretion and mucosal growth in the gastrointestinal tract, and anxiety, pain sensation and memory in the brain. Mice lacking the encoded protein exhibit an increase in the basal gastric pH and gastrin levels in the bloodstream as well as mild hypocalcemia, secondary hyperparathyroidism and increased bone resorption. [provided by RefSeq, Apr 2015]
PHENOTYPE: Nullizygous mice show gastic mucoca defects, high gastic pH and hypergastrenemia. Homozygotes for a null allele also exhibit higher energy intake and expenditure, less susceptibility to endotoxin shock, altered pain and mechanical sensitivity, and behavioral changes to isolation and addictive drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik ACACACACCCGC AC 4: 136,462,350 probably null Het
AI182371 A G 2: 35,089,197 V153A possibly damaging Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,560,922 probably benign Het
Apoc2 C T 7: 19,671,842 M71I probably benign Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Atrn C A 2: 130,906,922 T121K probably benign Het
Ccdc170 C CCAG 10: 4,561,030 probably benign Het
Cdk13 T C 13: 17,803,744 D303G unknown Het
Cfap65 C A 1: 74,905,647 R1477L probably damaging Het
Chd2 A G 7: 73,519,662 S37P possibly damaging Het
Chga AGC AGCCGC 12: 102,561,420 probably benign Het
Csf2rb2 T C 15: 78,291,927 I259V probably benign Het
Csnk1d A T 11: 120,971,627 N275K possibly damaging Het
Dmxl1 A C 18: 49,893,394 R1856S probably damaging Het
Dnah5 T C 15: 28,204,019 V14A probably benign Het
Edc4 G A 8: 105,889,180 S729N probably benign Het
Emilin3 T C 2: 160,909,092 S246G probably benign Het
Epc2 T G 2: 49,532,237 probably null Het
Exoc6 T A 19: 37,571,620 F101I probably benign Het
Fam171b GCAGCA GCAGCACCAGCA 2: 83,812,880 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAGTCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Gab3 TTC TTCCTC X: 74,999,992 probably benign Het
Gab3 CTT CTTATT X: 75,000,024 probably null Het
Gabpa C A 16: 84,844,336 Q93K probably benign Het
Gabre GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC X: 72,270,712 probably benign Het
Gabre GGCTCA GGCTCAAGCTCA X: 72,270,713 probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,167 probably null Het
Gm36028 T C 16: 37,854,479 D207G probably benign Het
H2-T3 TCCCGAAGAAC TC 17: 36,189,402 probably benign Het
Htr5a A G 5: 27,842,861 D138G probably damaging Het
Ifna13 T A 4: 88,643,908 S160C probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Klri2 GGAG GG 6: 129,733,774 probably null Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lrch4 A G 5: 137,637,543 probably null Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Map1a GCTCCAGC GCTCCAGCCCCAGCTCCAGCTCCAGCTCCACCTCCAGC 2: 121,306,301 probably benign Het
Mex3b A G 7: 82,867,760 D37G probably damaging Het
Mon1a T A 9: 107,901,234 V219E probably damaging Het
Myh3 GATTA GATTAATTA 11: 67,086,355 probably null Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 TTACG TTACGTACG 11: 67,086,357 probably null Het
Myo5b T A 18: 74,643,999 C377S probably damaging Het
Nefh ACTTGGCCTCAGCTGGGG ACTTGGCCTCAGCTGGGGCCTTGGCCTCAGCTGGGG 11: 4,940,997 probably benign Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Olfr194 T A 16: 59,119,911 H53L probably damaging Het
Olfr884 A T 9: 38,047,747 H175L probably damaging Het
Oog2 T C 4: 144,195,285 V255A probably benign Het
Pdgfd C A 9: 6,288,624 L93M probably damaging Het
Pgls G T 8: 71,592,463 V83L probably damaging Het
Pigw C A 11: 84,877,161 Q447H probably damaging Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Poc1a C A 9: 106,295,218 L253M possibly damaging Het
Ppl T A 16: 5,097,931 E589D probably benign Het
Prkar1b A G 5: 139,108,621 S71P probably benign Het
Prx T C 7: 27,518,960 F1101S probably damaging Het
Rffl A G 11: 82,845,772 V26A probably benign Het
Scube3 T A 17: 28,168,397 L923Q probably damaging Het
Setd2 C T 9: 110,550,711 P1198L probably damaging Het
Shank2 C A 7: 144,411,571 A972E possibly damaging Het
Slc10a6 A G 5: 103,608,992 L302P probably damaging Het
Slc29a3 C T 10: 60,750,561 G42D probably benign Het
Spg20 T C 3: 55,127,606 V471A probably benign Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Sspo T A 6: 48,459,985 Y1284* probably null Het
Supt20 AGCAGC AGCAGCCGCAGC 3: 54,727,662 probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tff1 CTTCCTG C 17: 31,164,927 probably benign Het
Tmprss13 ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC ATCTCCAGCAAGGGCACCTCCTCAGGGCTCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC 9: 45,328,464 probably benign Het
Tnfrsf25 T C 4: 152,119,624 W341R probably damaging Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,287 probably benign Het
Trav8d-1 T A 14: 52,778,750 L31Q probably damaging Het
Ttc23 A T 7: 67,726,029 I452F possibly damaging Het
Uimc1 T C 13: 55,050,785 E526G possibly damaging Het
Ulbp1 T A 10: 7,447,405 K233N unknown Het
Utrn T TGTTACCC 10: 12,633,945 probably null Het
Vmn1r9 C T 6: 57,071,480 S180L probably benign Het
Zfp598 CACC CACCCCTACC 17: 24,680,787 probably benign Het
Other mutations in Cckbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Cckbr APN 7 105434242 missense probably benign 0.01
IGL01630:Cckbr APN 7 105434086 missense probably damaging 1.00
IGL01931:Cckbr APN 7 105426103 missense probably benign
IGL01955:Cckbr APN 7 105434962 missense probably damaging 0.97
IGL02219:Cckbr APN 7 105434048 missense probably damaging 1.00
IGL02820:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02858:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02878:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02946:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL03179:Cckbr APN 7 105434923 missense probably benign 0.02
FR4548:Cckbr UTSW 7 105434681 small deletion probably benign
R0380:Cckbr UTSW 7 105434991 missense probably benign 0.00
R1767:Cckbr UTSW 7 105434551 missense possibly damaging 0.56
R3890:Cckbr UTSW 7 105426169 missense probably benign 0.00
R3892:Cckbr UTSW 7 105426169 missense probably benign 0.00
R5116:Cckbr UTSW 7 105433655 missense probably damaging 1.00
R5589:Cckbr UTSW 7 105434525 missense probably damaging 0.98
R5975:Cckbr UTSW 7 105470619 missense probably benign 0.07
R6797:Cckbr UTSW 7 105434566 missense possibly damaging 0.85
R6940:Cckbr UTSW 7 105434896 missense probably benign 0.00
R7194:Cckbr UTSW 7 105435345 missense possibly damaging 0.72
R7293:Cckbr UTSW 7 105434645 missense probably benign 0.05
R7581:Cckbr UTSW 7 105433786 missense probably benign 0.05
R7793:Cckbr UTSW 7 105433591 missense probably benign 0.00
R7891:Cckbr UTSW 7 105435350 missense probably benign 0.00
R7974:Cckbr UTSW 7 105435350 missense probably benign 0.00
RF039:Cckbr UTSW 7 105434686 frame shift probably null
RF062:Cckbr UTSW 7 105434687 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGTCCGTGCTTCTGCTAATAC -3'
(R):5'- AGCAGCCATCACTGTCTTCC -3'

Sequencing Primer
(F):5'- GTGCTTCTGCTAATACTGCTG -3'
(R):5'- AGTCAGGCTGGTCACATGC -3'
Posted On2019-12-04