Incidental Mutation 'RF009:Ccdc170'
ID603065
Institutional Source Beutler Lab
Gene Symbol Ccdc170
Ensembl Gene ENSMUSG00000019767
Gene Namecoiled-coil domain containing 170
SynonymsGm221, LOC237250
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #RF009 (G1)
Quality Score149.467
Status Not validated
Chromosome10
Chromosomal Location4482502-4562231 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) C to CCAG at 4561030 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019901] [ENSMUST00000138112]
Predicted Effect probably benign
Transcript: ENSMUST00000019901
SMART Domains Protein: ENSMUSP00000019901
Gene: ENSMUSG00000019767

DomainStartEndE-ValueType
coiled coil region 40 160 N/A INTRINSIC
coiled coil region 264 302 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
coiled coil region 379 415 N/A INTRINSIC
coiled coil region 475 649 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138112
SMART Domains Protein: ENSMUSP00000115997
Gene: ENSMUSG00000019767

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
internal_repeat_1 80 93 6.25e-5 PROSPERO
internal_repeat_1 305 318 6.25e-5 PROSPERO
low complexity region 351 363 N/A INTRINSIC
coiled coil region 385 421 N/A INTRINSIC
coiled coil region 481 655 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene and its encoded protein is not known. Several genome-wide association studies have implicated the region around this gene to be involved in breast cancer and bone mineral density, but no link to this specific gene has been found. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik ACACACACCCGC AC 4: 136,462,350 probably null Het
AI182371 A G 2: 35,089,197 V153A possibly damaging Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,560,922 probably benign Het
Apoc2 C T 7: 19,671,842 M71I probably benign Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Atrn C A 2: 130,906,922 T121K probably benign Het
Cckbr GCA G 7: 105,434,686 probably null Het
Cdk13 T C 13: 17,803,744 D303G unknown Het
Cfap65 C A 1: 74,905,647 R1477L probably damaging Het
Chd2 A G 7: 73,519,662 S37P possibly damaging Het
Chga AGC AGCCGC 12: 102,561,420 probably benign Het
Csf2rb2 T C 15: 78,291,927 I259V probably benign Het
Csnk1d A T 11: 120,971,627 N275K possibly damaging Het
Dmxl1 A C 18: 49,893,394 R1856S probably damaging Het
Dnah5 T C 15: 28,204,019 V14A probably benign Het
Edc4 G A 8: 105,889,180 S729N probably benign Het
Emilin3 T C 2: 160,909,092 S246G probably benign Het
Epc2 T G 2: 49,532,237 probably null Het
Exoc6 T A 19: 37,571,620 F101I probably benign Het
Fam171b GCAGCA GCAGCACCAGCA 2: 83,812,880 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAGTCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Gab3 TTC TTCCTC X: 74,999,992 probably benign Het
Gab3 CTT CTTATT X: 75,000,024 probably null Het
Gabpa C A 16: 84,844,336 Q93K probably benign Het
Gabre GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC X: 72,270,712 probably benign Het
Gabre GGCTCA GGCTCAAGCTCA X: 72,270,713 probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,167 probably null Het
Gm36028 T C 16: 37,854,479 D207G probably benign Het
H2-T3 TCCCGAAGAAC TC 17: 36,189,402 probably benign Het
Htr5a A G 5: 27,842,861 D138G probably damaging Het
Ifi207 G A 1: 173,728,992 P727S probably benign Het
Ifna13 T A 4: 88,643,908 S160C probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Klri2 GGAG GG 6: 129,733,774 probably null Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lrch4 A G 5: 137,637,543 probably null Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Map1a GCTCCAGC GCTCCAGCCCCAGCTCCAGCTCCAGCTCCACCTCCAGC 2: 121,306,301 probably benign Het
Mettl25 T C 10: 105,833,239 probably benign Het
Mex3b A G 7: 82,867,760 D37G probably damaging Het
Mon1a T A 9: 107,901,234 V219E probably damaging Het
Myh3 GATTA GATTAATTA 11: 67,086,355 probably null Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 TTACG TTACGTACG 11: 67,086,357 probably null Het
Myo5b T A 18: 74,643,999 C377S probably damaging Het
Nefh ACTTGGCCTCAGCTGGGG ACTTGGCCTCAGCTGGGGCCTTGGCCTCAGCTGGGG 11: 4,940,997 probably benign Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Ntn5 T C 7: 45,693,260 probably null Het
Olfr194 T A 16: 59,119,911 H53L probably damaging Het
Olfr884 A T 9: 38,047,747 H175L probably damaging Het
Oog2 T C 4: 144,195,285 V255A probably benign Het
Pdgfd C A 9: 6,288,624 L93M probably damaging Het
Pgls G T 8: 71,592,463 V83L probably damaging Het
Pigw C A 11: 84,877,161 Q447H probably damaging Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Poc1a C A 9: 106,295,218 L253M possibly damaging Het
Ppl T A 16: 5,097,931 E589D probably benign Het
Prkar1b A G 5: 139,108,621 S71P probably benign Het
Prx T C 7: 27,518,960 F1101S probably damaging Het
Rffl A G 11: 82,845,772 V26A probably benign Het
Scube3 T A 17: 28,168,397 L923Q probably damaging Het
Setd2 C T 9: 110,550,711 P1198L probably damaging Het
Shank2 C A 7: 144,411,571 A972E possibly damaging Het
Slc10a6 A G 5: 103,608,992 L302P probably damaging Het
Slc29a3 C T 10: 60,750,561 G42D probably benign Het
Spg20 T C 3: 55,127,606 V471A probably benign Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Sspo T A 6: 48,459,985 Y1284* probably null Het
Supt20 AGCAGC AGCAGCCGCAGC 3: 54,727,662 probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tff1 CTTCCTG C 17: 31,164,927 probably benign Het
Tmprss13 ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC ATCTCCAGCAAGGGCACCTCCTCAGGGCTCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC 9: 45,328,464 probably benign Het
Tnfrsf25 T C 4: 152,119,624 W341R probably damaging Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,287 probably benign Het
Trav8d-1 T A 14: 52,778,750 L31Q probably damaging Het
Ttc23 A T 7: 67,726,029 I452F possibly damaging Het
Uimc1 T C 13: 55,050,785 E526G possibly damaging Het
Ulbp1 T A 10: 7,447,405 K233N unknown Het
Usp17ld A T 7: 103,250,288 V479E probably damaging Het
Utrn T TGTTACCC 10: 12,633,945 probably null Het
Vmn1r9 C T 6: 57,071,480 S180L probably benign Het
Zfp598 CACC CACCCCTACC 17: 24,680,787 probably benign Het
Other mutations in Ccdc170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ccdc170 APN 10 4546836 missense probably damaging 1.00
IGL01018:Ccdc170 APN 10 4512788 missense probably benign
IGL01018:Ccdc170 APN 10 4514155 missense probably benign 0.00
IGL01018:Ccdc170 APN 10 4514114 missense probably benign
IGL01114:Ccdc170 APN 10 4558550 missense probably benign 0.01
IGL01377:Ccdc170 APN 10 4560966 missense probably damaging 1.00
IGL01726:Ccdc170 APN 10 4549713 missense probably benign 0.04
IGL02110:Ccdc170 APN 10 4541885 splice site probably null
FR4304:Ccdc170 UTSW 10 4561021 small insertion probably benign
FR4548:Ccdc170 UTSW 10 4561026 small insertion probably benign
FR4737:Ccdc170 UTSW 10 4561023 small insertion probably benign
FR4737:Ccdc170 UTSW 10 4561029 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561008 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561023 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561029 small insertion probably benign
R0137:Ccdc170 UTSW 10 4546950 splice site probably benign
R0280:Ccdc170 UTSW 10 4558663 missense possibly damaging 0.62
R0480:Ccdc170 UTSW 10 4518939 missense probably benign 0.00
R1786:Ccdc170 UTSW 10 4519043 missense probably benign 0.02
R2383:Ccdc170 UTSW 10 4534208 missense probably benign 0.00
R3031:Ccdc170 UTSW 10 4518931 missense probably damaging 0.99
R3797:Ccdc170 UTSW 10 4560920 missense possibly damaging 0.60
R4494:Ccdc170 UTSW 10 4514128 missense probably damaging 1.00
R4916:Ccdc170 UTSW 10 4518971 missense probably damaging 0.96
R5152:Ccdc170 UTSW 10 4561107 missense probably damaging 1.00
R5170:Ccdc170 UTSW 10 4514200 missense probably damaging 0.99
R5354:Ccdc170 UTSW 10 4534188 missense probably benign 0.16
R5911:Ccdc170 UTSW 10 4558551 nonsense probably null
R5983:Ccdc170 UTSW 10 4520851 nonsense probably null
R6374:Ccdc170 UTSW 10 4549746 nonsense probably null
R6645:Ccdc170 UTSW 10 4560974 missense possibly damaging 0.95
R6818:Ccdc170 UTSW 10 4541782 missense probably damaging 1.00
R6888:Ccdc170 UTSW 10 4546854 missense possibly damaging 0.91
R7032:Ccdc170 UTSW 10 4482597 missense unknown
R7206:Ccdc170 UTSW 10 4514120 missense possibly damaging 0.66
R7393:Ccdc170 UTSW 10 4514314 critical splice donor site probably null
R7438:Ccdc170 UTSW 10 4558512 nonsense probably null
R7471:Ccdc170 UTSW 10 4520803 missense probably benign 0.00
R7514:Ccdc170 UTSW 10 4546839 missense probably benign 0.37
R7818:Ccdc170 UTSW 10 4549603 missense probably benign 0.05
RF006:Ccdc170 UTSW 10 4561030 small insertion probably benign
RF011:Ccdc170 UTSW 10 4561018 small insertion probably benign
RF017:Ccdc170 UTSW 10 4561024 small insertion probably benign
RF023:Ccdc170 UTSW 10 4561018 small insertion probably benign
RF024:Ccdc170 UTSW 10 4561024 small insertion probably benign
RF025:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF027:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF029:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF050:Ccdc170 UTSW 10 4561008 small insertion probably benign
RF064:Ccdc170 UTSW 10 4561025 small insertion probably benign
Z1177:Ccdc170 UTSW 10 4509884 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATTGTTGTTGCACTTGACCCAG -3'
(R):5'- GTCACACACTATGGCTGAATTTC -3'

Sequencing Primer
(F):5'- GTTGCACTTGACCCAGCAATG -3'
(R):5'- CACAACTGGAGAATCGTAC -3'
Posted On2019-12-04