Incidental Mutation 'RF009:Chga'
ID603077
Institutional Source Beutler Lab
Gene Symbol Chga
Ensembl Gene ENSMUSG00000021194
Gene Namechromogranin A
SynonymsChrA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #RF009 (G1)
Quality Score199.468
Status Not validated
Chromosome12
Chromosomal Location102554969-102565028 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) AGC to AGCCGC at 102561420 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021610]
Predicted Effect probably benign
Transcript: ENSMUST00000021610
SMART Domains Protein: ENSMUSP00000021610
Gene: ENSMUSG00000021194

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Granin 25 95 3e-26 PFAM
Pfam:Granin 87 463 1.7e-95 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: This gene encodes a member of the granin family of acidic secretory glycoproteins that are expressed in endocrine cells and neurons. The encoded preproprotein undergoes proteolytic processing to generate multiple functions peptides including pancreastatin, catestatin and serpinin. The encoded protein plays important roles in the neuroendocrine system including regulated secretion of peptide hormones and neurotransmitters. Mice lacking the encoded protein exhibit elevated blood pressure which can be rescued by transgenic expression of the human ortholog. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes and heterozygotes for one allele display hypertension, abnormal plasma and adrenal adrenaline and noradrenaline levels and, in homozygotes, partial embryonic lethality. Homozygotes for a second allele only have elevated urinary adrenaline, noradrenaline and dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik ACACACACCCGC AC 4: 136,462,350 probably null Het
AI182371 A G 2: 35,089,197 V153A possibly damaging Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,560,922 probably benign Het
Apoc2 C T 7: 19,671,842 M71I probably benign Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Atrn C A 2: 130,906,922 T121K probably benign Het
Ccdc170 C CCAG 10: 4,561,030 probably benign Het
Cckbr GCA G 7: 105,434,686 probably null Het
Cdk13 T C 13: 17,803,744 D303G unknown Het
Cfap65 C A 1: 74,905,647 R1477L probably damaging Het
Chd2 A G 7: 73,519,662 S37P possibly damaging Het
Csf2rb2 T C 15: 78,291,927 I259V probably benign Het
Csnk1d A T 11: 120,971,627 N275K possibly damaging Het
Dmxl1 A C 18: 49,893,394 R1856S probably damaging Het
Dnah5 T C 15: 28,204,019 V14A probably benign Het
Edc4 G A 8: 105,889,180 S729N probably benign Het
Emilin3 T C 2: 160,909,092 S246G probably benign Het
Epc2 T G 2: 49,532,237 probably null Het
Exoc6 T A 19: 37,571,620 F101I probably benign Het
Fam171b GCAGCA GCAGCACCAGCA 2: 83,812,880 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAGTCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Gab3 TTC TTCCTC X: 74,999,992 probably benign Het
Gab3 CTT CTTATT X: 75,000,024 probably null Het
Gabpa C A 16: 84,844,336 Q93K probably benign Het
Gabre GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC X: 72,270,712 probably benign Het
Gabre GGCTCA GGCTCAAGCTCA X: 72,270,713 probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,167 probably null Het
Gm36028 T C 16: 37,854,479 D207G probably benign Het
H2-T3 TCCCGAAGAAC TC 17: 36,189,402 probably benign Het
Htr5a A G 5: 27,842,861 D138G probably damaging Het
Ifi207 G A 1: 173,728,992 P727S probably benign Het
Ifna13 T A 4: 88,643,908 S160C probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Klri2 GGAG GG 6: 129,733,774 probably null Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lrch4 A G 5: 137,637,543 probably null Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Map1a GCTCCAGC GCTCCAGCCCCAGCTCCAGCTCCAGCTCCACCTCCAGC 2: 121,306,301 probably benign Het
Mettl25 T C 10: 105,833,239 probably benign Het
Mex3b A G 7: 82,867,760 D37G probably damaging Het
Mon1a T A 9: 107,901,234 V219E probably damaging Het
Myh3 GATTA GATTAATTA 11: 67,086,355 probably null Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 TTACG TTACGTACG 11: 67,086,357 probably null Het
Myo5b T A 18: 74,643,999 C377S probably damaging Het
Nefh ACTTGGCCTCAGCTGGGG ACTTGGCCTCAGCTGGGGCCTTGGCCTCAGCTGGGG 11: 4,940,997 probably benign Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Ntn5 T C 7: 45,693,260 probably null Het
Olfr194 T A 16: 59,119,911 H53L probably damaging Het
Olfr884 A T 9: 38,047,747 H175L probably damaging Het
Oog2 T C 4: 144,195,285 V255A probably benign Het
Pdgfd C A 9: 6,288,624 L93M probably damaging Het
Pgls G T 8: 71,592,463 V83L probably damaging Het
Pigw C A 11: 84,877,161 Q447H probably damaging Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Poc1a C A 9: 106,295,218 L253M possibly damaging Het
Ppl T A 16: 5,097,931 E589D probably benign Het
Prkar1b A G 5: 139,108,621 S71P probably benign Het
Prx T C 7: 27,518,960 F1101S probably damaging Het
Rffl A G 11: 82,845,772 V26A probably benign Het
Scube3 T A 17: 28,168,397 L923Q probably damaging Het
Setd2 C T 9: 110,550,711 P1198L probably damaging Het
Shank2 C A 7: 144,411,571 A972E possibly damaging Het
Slc10a6 A G 5: 103,608,992 L302P probably damaging Het
Slc29a3 C T 10: 60,750,561 G42D probably benign Het
Spg20 T C 3: 55,127,606 V471A probably benign Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Sspo T A 6: 48,459,985 Y1284* probably null Het
Supt20 AGCAGC AGCAGCCGCAGC 3: 54,727,662 probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tff1 CTTCCTG C 17: 31,164,927 probably benign Het
Tmprss13 ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC ATCTCCAGCAAGGGCACCTCCTCAGGGCTCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC 9: 45,328,464 probably benign Het
Tnfrsf25 T C 4: 152,119,624 W341R probably damaging Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,287 probably benign Het
Trav8d-1 T A 14: 52,778,750 L31Q probably damaging Het
Ttc23 A T 7: 67,726,029 I452F possibly damaging Het
Uimc1 T C 13: 55,050,785 E526G possibly damaging Het
Ulbp1 T A 10: 7,447,405 K233N unknown Het
Usp17ld A T 7: 103,250,288 V479E probably damaging Het
Utrn T TGTTACCC 10: 12,633,945 probably null Het
Vmn1r9 C T 6: 57,071,480 S180L probably benign Het
Zfp598 CACC CACCCCTACC 17: 24,680,787 probably benign Het
Other mutations in Chga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chga APN 12 102562799 missense probably damaging 0.98
IGL02674:Chga APN 12 102562901 missense probably damaging 1.00
FR4589:Chga UTSW 12 102561402 small insertion probably benign
R0018:Chga UTSW 12 102558505 missense probably damaging 0.97
R0463:Chga UTSW 12 102562951 nonsense probably null
R1164:Chga UTSW 12 102563045 missense probably damaging 1.00
R1603:Chga UTSW 12 102564607 splice site probably null
R1727:Chga UTSW 12 102561437 missense possibly damaging 0.85
R1778:Chga UTSW 12 102561700 missense probably benign
R1800:Chga UTSW 12 102555905 missense probably damaging 0.99
R2071:Chga UTSW 12 102562863 missense probably damaging 1.00
R3415:Chga UTSW 12 102562784 missense probably benign 0.00
R3696:Chga UTSW 12 102561465 missense probably damaging 0.98
R5022:Chga UTSW 12 102562837 missense probably damaging 1.00
R5507:Chga UTSW 12 102562609 missense probably benign 0.39
R5959:Chga UTSW 12 102561855 missense probably benign
R7338:Chga UTSW 12 102562841 missense probably damaging 1.00
R7410:Chga UTSW 12 102562607 missense probably benign 0.00
R7694:Chga UTSW 12 102561347 missense probably benign 0.05
R8084:Chga UTSW 12 102562069 missense probably benign 0.29
R8211:Chga UTSW 12 102561419 missense possibly damaging 0.71
RF001:Chga UTSW 12 102561423 small insertion probably benign
RF002:Chga UTSW 12 102561421 small insertion probably benign
RF006:Chga UTSW 12 102561412 small insertion probably benign
RF010:Chga UTSW 12 102561403 small insertion probably benign
RF014:Chga UTSW 12 102561393 small insertion probably benign
RF014:Chga UTSW 12 102561405 small insertion probably benign
RF015:Chga UTSW 12 102561420 small insertion probably benign
RF022:Chga UTSW 12 102561420 small insertion probably benign
RF033:Chga UTSW 12 102561396 small insertion probably benign
RF035:Chga UTSW 12 102561427 small insertion probably benign
RF044:Chga UTSW 12 102561396 small insertion probably benign
RF048:Chga UTSW 12 102561403 small insertion probably benign
RF048:Chga UTSW 12 102561421 small insertion probably benign
RF049:Chga UTSW 12 102561393 small insertion probably benign
RF052:Chga UTSW 12 102561416 small insertion probably benign
RF054:Chga UTSW 12 102561423 small insertion probably benign
RF056:Chga UTSW 12 102561424 small insertion probably benign
RF058:Chga UTSW 12 102561416 small insertion probably benign
RF060:Chga UTSW 12 102561424 small insertion probably benign
RF061:Chga UTSW 12 102561413 small insertion probably benign
RF061:Chga UTSW 12 102561427 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GAACTTTCTCACATTTCCCACTAGG -3'
(R):5'- GCTGACTTCCTGCTGTGAAG -3'

Sequencing Primer
(F):5'- GGCCTGATGGGTATAGCTGAGAG -3'
(R):5'- CTTCCTGCTGTGAAGAAGCAG -3'
Posted On2019-12-04