Incidental Mutation 'RF009:Ankhd1'
ID603097
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Nameankyrin repeat and KH domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF009 (G1)
Quality Score217.468
Status Not validated
Chromosome18
Chromosomal Location36559987-36665917 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GCGGCG to GCGGCGTCGGCG at 36560922 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
Predicted Effect probably benign
Transcript: ENSMUST00000006205
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134146
SMART Domains Protein: ENSMUSP00000122136
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 17 35 N/A INTRINSIC
ANK 140 169 2.11e2 SMART
ANK 173 202 3.31e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142977
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155329
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik ACACACACCCGC AC 4: 136,462,350 probably null Het
AI182371 A G 2: 35,089,197 V153A possibly damaging Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Apoc2 C T 7: 19,671,842 M71I probably benign Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Atrn C A 2: 130,906,922 T121K probably benign Het
Ccdc170 C CCAG 10: 4,561,030 probably benign Het
Cckbr GCA G 7: 105,434,686 probably null Het
Cdk13 T C 13: 17,803,744 D303G unknown Het
Cfap65 C A 1: 74,905,647 R1477L probably damaging Het
Chd2 A G 7: 73,519,662 S37P possibly damaging Het
Chga AGC AGCCGC 12: 102,561,420 probably benign Het
Csf2rb2 T C 15: 78,291,927 I259V probably benign Het
Csnk1d A T 11: 120,971,627 N275K possibly damaging Het
Dmxl1 A C 18: 49,893,394 R1856S probably damaging Het
Dnah5 T C 15: 28,204,019 V14A probably benign Het
Edc4 G A 8: 105,889,180 S729N probably benign Het
Emilin3 T C 2: 160,909,092 S246G probably benign Het
Epc2 T G 2: 49,532,237 probably null Het
Exoc6 T A 19: 37,571,620 F101I probably benign Het
Fam171b GCAGCA GCAGCACCAGCA 2: 83,812,880 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAGTCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Gab3 TTC TTCCTC X: 74,999,992 probably benign Het
Gab3 CTT CTTATT X: 75,000,024 probably null Het
Gabpa C A 16: 84,844,336 Q93K probably benign Het
Gabre GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC X: 72,270,712 probably benign Het
Gabre GGCTCA GGCTCAAGCTCA X: 72,270,713 probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,167 probably null Het
Gm36028 T C 16: 37,854,479 D207G probably benign Het
H2-T3 TCCCGAAGAAC TC 17: 36,189,402 probably benign Het
Htr5a A G 5: 27,842,861 D138G probably damaging Het
Ifi207 G A 1: 173,728,992 P727S probably benign Het
Ifna13 T A 4: 88,643,908 S160C probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Klri2 GGAG GG 6: 129,733,774 probably null Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lrch4 A G 5: 137,637,543 probably null Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Map1a GCTCCAGC GCTCCAGCCCCAGCTCCAGCTCCAGCTCCACCTCCAGC 2: 121,306,301 probably benign Het
Mettl25 T C 10: 105,833,239 probably benign Het
Mex3b A G 7: 82,867,760 D37G probably damaging Het
Mon1a T A 9: 107,901,234 V219E probably damaging Het
Myh3 GATTA GATTAATTA 11: 67,086,355 probably null Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 TTACG TTACGTACG 11: 67,086,357 probably null Het
Myo5b T A 18: 74,643,999 C377S probably damaging Het
Nefh ACTTGGCCTCAGCTGGGG ACTTGGCCTCAGCTGGGGCCTTGGCCTCAGCTGGGG 11: 4,940,997 probably benign Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Ntn5 T C 7: 45,693,260 probably null Het
Olfr194 T A 16: 59,119,911 H53L probably damaging Het
Olfr884 A T 9: 38,047,747 H175L probably damaging Het
Oog2 T C 4: 144,195,285 V255A probably benign Het
Pdgfd C A 9: 6,288,624 L93M probably damaging Het
Pgls G T 8: 71,592,463 V83L probably damaging Het
Pigw C A 11: 84,877,161 Q447H probably damaging Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Poc1a C A 9: 106,295,218 L253M possibly damaging Het
Ppl T A 16: 5,097,931 E589D probably benign Het
Prkar1b A G 5: 139,108,621 S71P probably benign Het
Prx T C 7: 27,518,960 F1101S probably damaging Het
Rffl A G 11: 82,845,772 V26A probably benign Het
Scube3 T A 17: 28,168,397 L923Q probably damaging Het
Setd2 C T 9: 110,550,711 P1198L probably damaging Het
Shank2 C A 7: 144,411,571 A972E possibly damaging Het
Slc10a6 A G 5: 103,608,992 L302P probably damaging Het
Slc29a3 C T 10: 60,750,561 G42D probably benign Het
Spg20 T C 3: 55,127,606 V471A probably benign Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Sspo T A 6: 48,459,985 Y1284* probably null Het
Supt20 AGCAGC AGCAGCCGCAGC 3: 54,727,662 probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tff1 CTTCCTG C 17: 31,164,927 probably benign Het
Tmprss13 ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC ATCTCCAGCAAGGGCACCTCCTCAGGGCTCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC 9: 45,328,464 probably benign Het
Tnfrsf25 T C 4: 152,119,624 W341R probably damaging Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,287 probably benign Het
Trav8d-1 T A 14: 52,778,750 L31Q probably damaging Het
Ttc23 A T 7: 67,726,029 I452F possibly damaging Het
Uimc1 T C 13: 55,050,785 E526G possibly damaging Het
Ulbp1 T A 10: 7,447,405 K233N unknown Het
Usp17ld A T 7: 103,250,288 V479E probably damaging Het
Utrn T TGTTACCC 10: 12,633,945 probably null Het
Vmn1r9 C T 6: 57,071,480 S180L probably benign Het
Zfp598 CACC CACCCCTACC 17: 24,680,787 probably benign Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36665459 unclassified probably benign
IGL00927:Ankhd1 APN 18 36632072 missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36578643 missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36658013 missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36648153 missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36648374 missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36648426 missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36624661 missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36656726 missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36594814 missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36647703 missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36578775 critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36648546 missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36594823 missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36658008 nonsense probably null
IGL03163:Ankhd1 APN 18 36647628 missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36578774 missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36647777 missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36656837 splice site probably benign
FR4304:Ankhd1 UTSW 18 36560924 small insertion probably benign
R0051:Ankhd1 UTSW 18 36647188 unclassified probably benign
R0089:Ankhd1 UTSW 18 36640356 missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36646766 missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36634734 missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36658008 nonsense probably null
R0361:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36634300 missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36645249 splice site probably benign
R1127:Ankhd1 UTSW 18 36634346 missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36625159 missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36625265 missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36647308 missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36644527 missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36648030 missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36645113 missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36641626 missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36634308 missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36647621 missense probably benign
R2196:Ankhd1 UTSW 18 36648379 missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36644333 missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36642926 missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36624765 missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36578543 intron probably null
R2958:Ankhd1 UTSW 18 36634729 missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36589540 missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36661048 unclassified probably benign
R4323:Ankhd1 UTSW 18 36578633 missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36643043 nonsense probably null
R4496:Ankhd1 UTSW 18 36560786 missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36655507 unclassified probably null
R4590:Ankhd1 UTSW 18 36583644 missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36648021 missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36578734 missense probably null 0.00
R4923:Ankhd1 UTSW 18 36589452 missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36625027 missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36656715 missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36561058 splice site probably null
R5336:Ankhd1 UTSW 18 36646716 missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36589408 missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36634644 missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36648485 missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36560807 missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36561050 missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36624902 missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36640269 missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36647524 missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36600834 missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36625126 missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36611809 missense possibly damaging 0.84
R6247:Ankhd1 UTSW 18 36654146 missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36591456 missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36600783 unclassified probably null
R6653:Ankhd1 UTSW 18 36600783 unclassified probably null
R6763:Ankhd1 UTSW 18 36642969 missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36648254 missense probably benign 0.00
R7075:Ankhd1 UTSW 18 36559989 missense
R7208:Ankhd1 UTSW 18 36625028 missense probably benign
R7305:Ankhd1 UTSW 18 36632205 missense
R7615:Ankhd1 UTSW 18 36656773 missense
R7654:Ankhd1 UTSW 18 36594101 missense probably damaging 1.00
R7781:Ankhd1 UTSW 18 36625205 missense probably damaging 1.00
R7842:Ankhd1 UTSW 18 36647828 missense probably benign 0.00
R7965:Ankhd1 UTSW 18 36658412 missense
R8006:Ankhd1 UTSW 18 36648719 missense
R8037:Ankhd1 UTSW 18 36638623 missense probably damaging 0.98
R8123:Ankhd1 UTSW 18 36575083 missense
R8195:Ankhd1 UTSW 18 36654177 missense
R8305:Ankhd1 UTSW 18 36647166 missense possibly damaging 0.79
RF001:Ankhd1 UTSW 18 36560921 small insertion probably benign
RF004:Ankhd1 UTSW 18 36560910 small insertion probably benign
RF007:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF008:Ankhd1 UTSW 18 36560924 small insertion probably benign
RF013:Ankhd1 UTSW 18 36560926 small insertion probably benign
RF016:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF016:Ankhd1 UTSW 18 36560910 small insertion probably benign
RF017:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF018:Ankhd1 UTSW 18 36560912 small insertion probably benign
RF026:Ankhd1 UTSW 18 36560912 small insertion probably benign
RF030:Ankhd1 UTSW 18 36560913 small insertion probably benign
RF030:Ankhd1 UTSW 18 36560927 small insertion probably benign
RF039:Ankhd1 UTSW 18 36560918 small insertion probably benign
RF043:Ankhd1 UTSW 18 36560917 small insertion probably benign
RF046:Ankhd1 UTSW 18 36560926 small insertion probably benign
RF047:Ankhd1 UTSW 18 36560917 small insertion probably benign
RF047:Ankhd1 UTSW 18 36560923 small insertion probably benign
RF049:Ankhd1 UTSW 18 36560923 small insertion probably benign
RF050:Ankhd1 UTSW 18 36560927 small insertion probably benign
RF054:Ankhd1 UTSW 18 36560929 small insertion probably benign
RF057:Ankhd1 UTSW 18 36560929 small insertion probably benign
RF060:Ankhd1 UTSW 18 36560922 small insertion probably benign
RF061:Ankhd1 UTSW 18 36560921 small insertion probably benign
RF062:Ankhd1 UTSW 18 36560918 small insertion probably benign
X0027:Ankhd1 UTSW 18 36624832 missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36578764 nonsense probably null
X0066:Ankhd1 UTSW 18 36646704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAACCATGCTGACGGAC -3'
(R):5'- CTGCTGTCAGAGAACACTGC -3'

Sequencing Primer
(F):5'- CTGACGGACAGCGGGGG -3'
(R):5'- TGCGGGTCCAAAGAATTCC -3'
Posted On2019-12-04