Incidental Mutation 'RF009:Dmxl1'
ID603098
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene NameDmx-like 1
SynonymsC630007L23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #RF009 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location49832670-49965473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 49893394 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1856 (R1856S)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041772
AA Change: R1856S

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: R1856S

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180611
AA Change: R1856S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: R1856S

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik ACACACACCCGC AC 4: 136,462,350 probably null Het
AI182371 A G 2: 35,089,197 V153A possibly damaging Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,560,922 probably benign Het
Apoc2 C T 7: 19,671,842 M71I probably benign Het
Arhgap17 CTGTTGTTG CTGTTG 7: 123,286,862 probably benign Het
Atrn C A 2: 130,906,922 T121K probably benign Het
Ccdc170 C CCAG 10: 4,561,030 probably benign Het
Cckbr GCA G 7: 105,434,686 probably null Het
Cdk13 T C 13: 17,803,744 D303G unknown Het
Cfap65 C A 1: 74,905,647 R1477L probably damaging Het
Chd2 A G 7: 73,519,662 S37P possibly damaging Het
Chga AGC AGCCGC 12: 102,561,420 probably benign Het
Csf2rb2 T C 15: 78,291,927 I259V probably benign Het
Csnk1d A T 11: 120,971,627 N275K possibly damaging Het
Dnah5 T C 15: 28,204,019 V14A probably benign Het
Edc4 G A 8: 105,889,180 S729N probably benign Het
Emilin3 T C 2: 160,909,092 S246G probably benign Het
Epc2 T G 2: 49,532,237 probably null Het
Exoc6 T A 19: 37,571,620 F101I probably benign Het
Fam171b GCAGCA GCAGCACCAGCA 2: 83,812,880 probably benign Het
Fam81b CTGTT CTGTTGTT 13: 76,271,316 probably benign Het
Flywch1 CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAGTCACCCACTCCTGGTGT 17: 23,762,161 probably null Het
Gab3 TTC TTCCTC X: 74,999,992 probably benign Het
Gab3 CTT CTTATT X: 75,000,024 probably null Het
Gabpa C A 16: 84,844,336 Q93K probably benign Het
Gabre GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC GGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCTGGCTCAGGCTC X: 72,270,712 probably benign Het
Gabre GGCTCA GGCTCAAGCTCA X: 72,270,713 probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,167 probably null Het
Gm36028 T C 16: 37,854,479 D207G probably benign Het
H2-T3 TCCCGAAGAAC TC 17: 36,189,402 probably benign Het
Htr5a A G 5: 27,842,861 D138G probably damaging Het
Ifi207 G A 1: 173,728,992 P727S probably benign Het
Ifna13 T A 4: 88,643,908 S160C probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Klri2 GGAG GG 6: 129,733,774 probably null Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lrch4 A G 5: 137,637,543 probably null Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Map1a GCTCCAGC GCTCCAGCCCCAGCTCCAGCTCCAGCTCCACCTCCAGC 2: 121,306,301 probably benign Het
Mettl25 T C 10: 105,833,239 probably benign Het
Mex3b A G 7: 82,867,760 D37G probably damaging Het
Mon1a T A 9: 107,901,234 V219E probably damaging Het
Myh3 GATTA GATTAATTA 11: 67,086,355 probably null Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 TTACG TTACGTACG 11: 67,086,357 probably null Het
Myo5b T A 18: 74,643,999 C377S probably damaging Het
Nefh ACTTGGCCTCAGCTGGGG ACTTGGCCTCAGCTGGGGCCTTGGCCTCAGCTGGGG 11: 4,940,997 probably benign Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Ntn5 T C 7: 45,693,260 probably null Het
Olfr194 T A 16: 59,119,911 H53L probably damaging Het
Olfr884 A T 9: 38,047,747 H175L probably damaging Het
Oog2 T C 4: 144,195,285 V255A probably benign Het
Pdgfd C A 9: 6,288,624 L93M probably damaging Het
Pgls G T 8: 71,592,463 V83L probably damaging Het
Pigw C A 11: 84,877,161 Q447H probably damaging Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Poc1a C A 9: 106,295,218 L253M possibly damaging Het
Ppl T A 16: 5,097,931 E589D probably benign Het
Prkar1b A G 5: 139,108,621 S71P probably benign Het
Prx T C 7: 27,518,960 F1101S probably damaging Het
Rffl A G 11: 82,845,772 V26A probably benign Het
Scube3 T A 17: 28,168,397 L923Q probably damaging Het
Setd2 C T 9: 110,550,711 P1198L probably damaging Het
Shank2 C A 7: 144,411,571 A972E possibly damaging Het
Slc10a6 A G 5: 103,608,992 L302P probably damaging Het
Slc29a3 C T 10: 60,750,561 G42D probably benign Het
Spg20 T C 3: 55,127,606 V471A probably benign Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Sspo T A 6: 48,459,985 Y1284* probably null Het
Supt20 AGCAGC AGCAGCCGCAGC 3: 54,727,662 probably benign Het
Tcof1 GCA GCACCA 18: 60,835,743 probably benign Het
Tff1 CTTCCTG C 17: 31,164,927 probably benign Het
Tmprss13 ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC ATCTCCAGCAAGGGCACCTCCTCAGGGCTCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC 9: 45,328,464 probably benign Het
Tnfrsf25 T C 4: 152,119,624 W341R probably damaging Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,287 probably benign Het
Trav8d-1 T A 14: 52,778,750 L31Q probably damaging Het
Ttc23 A T 7: 67,726,029 I452F possibly damaging Het
Uimc1 T C 13: 55,050,785 E526G possibly damaging Het
Ulbp1 T A 10: 7,447,405 K233N unknown Het
Usp17ld A T 7: 103,250,288 V479E probably damaging Het
Utrn T TGTTACCC 10: 12,633,945 probably null Het
Vmn1r9 C T 6: 57,071,480 S180L probably benign Het
Zfp598 CACC CACCCCTACC 17: 24,680,787 probably benign Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49851467 missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 49939553 missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 49917668 missense probably benign 0.00
IGL00969:Dmxl1 APN 18 49912725 missense probably benign 0.02
IGL01113:Dmxl1 APN 18 49912751 missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49857334 missense probably benign
IGL01475:Dmxl1 APN 18 49871714 missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 49920938 missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 49962205 missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49863025 missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49864868 missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 49878382 nonsense probably null
IGL01933:Dmxl1 APN 18 49877785 missense probably benign 0.17
IGL01952:Dmxl1 APN 18 49890654 missense probably benign 0.11
IGL02120:Dmxl1 APN 18 49894178 missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 49961163 missense probably benign 0.00
IGL02213:Dmxl1 APN 18 49877674 splice site probably benign
IGL02261:Dmxl1 APN 18 49840499 missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49864895 missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49859120 missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 49878180 missense probably benign 0.01
IGL03258:Dmxl1 APN 18 49920893 missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49864818 missense probably benign
hibiscus UTSW 18 49889467 missense probably damaging 1.00
pitcher UTSW 18 49864148 missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 49931963 missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 49888897 splice site probably benign
R0027:Dmxl1 UTSW 18 49957295 splice site probably benign
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0257:Dmxl1 UTSW 18 49955803 splice site probably benign
R0349:Dmxl1 UTSW 18 49879282 missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 49879362 missense probably benign 0.14
R0511:Dmxl1 UTSW 18 49891467 nonsense probably null
R0539:Dmxl1 UTSW 18 49857430 splice site probably benign
R0542:Dmxl1 UTSW 18 49893694 missense probably benign 0.05
R0587:Dmxl1 UTSW 18 49935307 missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49851423 splice site probably benign
R0744:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 49893402 missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 49893611 missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 49893225 missense probably benign
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 49888853 missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49857249 missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49852367 missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49859286 critical splice donor site probably null
R1638:Dmxl1 UTSW 18 49890767 nonsense probably null
R1646:Dmxl1 UTSW 18 49962261 missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 49934637 missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 49893444 nonsense probably null
R1732:Dmxl1 UTSW 18 49902988 missense probably benign
R1886:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1895:Dmxl1 UTSW 18 49955914 splice site probably null
R1911:Dmxl1 UTSW 18 49878163 missense probably benign 0.00
R2020:Dmxl1 UTSW 18 49889558 nonsense probably null
R2116:Dmxl1 UTSW 18 49878817 missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 49917631 missense probably benign 0.00
R2206:Dmxl1 UTSW 18 49894094 missense probably benign 0.12
R2216:Dmxl1 UTSW 18 49893923 missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49846639 missense probably benign 0.34
R2333:Dmxl1 UTSW 18 49919976 splice site probably null
R2343:Dmxl1 UTSW 18 49890678 missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 49880791 missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49863962 missense probably benign
R4033:Dmxl1 UTSW 18 49851431 missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 49961197 missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 49878017 nonsense probably null
R4406:Dmxl1 UTSW 18 49889553 missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49848761 missense probably benign
R4454:Dmxl1 UTSW 18 49893332 missense probably benign 0.01
R4459:Dmxl1 UTSW 18 49961216 missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 49962181 missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 49878631 missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 49878021 missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49862992 missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49851476 missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 49889467 missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 49957281 intron probably benign
R4885:Dmxl1 UTSW 18 49878795 missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 49895127 missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 49870923 missense probably benign 0.00
R5177:Dmxl1 UTSW 18 49893584 missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 49951235 missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49863119 critical splice donor site probably null
R5433:Dmxl1 UTSW 18 49867899 splice site probably null
R5484:Dmxl1 UTSW 18 49889464 missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49864478 missense probably benign 0.04
R5633:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 49891626 missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 49894257 missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 49931941 nonsense probably null
R5706:Dmxl1 UTSW 18 49957395 critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49846586 missense probably benign
R5876:Dmxl1 UTSW 18 49870984 missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49857386 missense probably benign 0.00
R6145:Dmxl1 UTSW 18 49912766 missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 49893335 missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49863015 missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 49902367 missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 49871732 missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49846586 missense probably benign
R6319:Dmxl1 UTSW 18 49852300 missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49864578 missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49859179 missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 49878246 missense probably benign 0.03
R6743:Dmxl1 UTSW 18 49880780 missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 49893974 missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49852288 nonsense probably null
R6857:Dmxl1 UTSW 18 49864835 missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 49935305 missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49843784 critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 49920902 missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49851495 missense probably null 0.99
R6897:Dmxl1 UTSW 18 49863057 missense possibly damaging 0.51
R6917:Dmxl1 UTSW 18 49864148 missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 49955853 missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49864614 missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 49878612 missense probably benign 0.00
R7570:Dmxl1 UTSW 18 49893957 missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 49902794 missense probably benign
R7629:Dmxl1 UTSW 18 49859270 missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 49893552 missense probably benign
R7688:Dmxl1 UTSW 18 49955871 missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49846618 missense probably benign 0.00
R7712:Dmxl1 UTSW 18 49893461 missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 49878315 missense probably benign 0.00
R7834:Dmxl1 UTSW 18 49920977 missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49840490 missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 49961147 missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49864383 missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 49893407 missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 49878433 missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 49888830 missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49843811 missense probably benign 0.17
X0025:Dmxl1 UTSW 18 49864368 missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 49919899 missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 49920965 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATGATGTCAGCCTGTAATCC -3'
(R):5'- AGAATGTGAGTGCCTCTCTGAG -3'

Sequencing Primer
(F):5'- CATGATGTCAGCCTGTAATCCTATAG -3'
(R):5'- ACCATTTGTCAGCGACGGTG -3'
Posted On2019-12-04