Incidental Mutation 'RF010:Stxbp1'
ID 603111
Institutional Source Beutler Lab
Gene Symbol Stxbp1
Ensembl Gene ENSMUSG00000026797
Gene Name syntaxin binding protein 1
Synonyms Rb-sec1, Munc18-1, Munc-18a, Sxtbp1, Unc18h, N-sec1, nsec1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock # RF010 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 32787602-32847245 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32821915 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 30 (V30A)
Ref Sequence ENSEMBL: ENSMUSP00000089051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050000] [ENSMUST00000077458] [ENSMUST00000208840]
AlphaFold O08599
Predicted Effect probably benign
Transcript: ENSMUST00000050000
AA Change: V30A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000052440
Gene: ENSMUSG00000026797
AA Change: V30A

Pfam:Sec1 28 582 9.8e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077458
AA Change: V30A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000089051
Gene: ENSMUSG00000026797
AA Change: V30A

Pfam:Sec1 29 581 2.8e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208840
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a syntaxin-binding protein. The encoded protein appears to play a role in release of neurotransmitters via regulation of syntaxin, a transmembrane attachment protein receptor. Mutations in this gene have been associated with infantile epileptic encephalopathy-4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit total loss of neurotransmitter secretion from synaptic vesicles throughout development and massive neuron apoptosis after initial synaptogenesis, leading to widespread neurodegeneration and complete neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Stxbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Stxbp1 APN 2 32812064 missense probably benign 0.00
IGL02743:Stxbp1 APN 2 32819901 missense probably damaging 0.98
volume UTSW 2 32801893 missense probably damaging 0.99
volume2 UTSW 2 32801883 missense possibly damaging 0.95
P0021:Stxbp1 UTSW 2 32823538 missense probably damaging 0.96
R0217:Stxbp1 UTSW 2 32801870 missense possibly damaging 0.69
R0269:Stxbp1 UTSW 2 32802783 missense probably damaging 1.00
R0285:Stxbp1 UTSW 2 32823542 missense probably benign 0.00
R0335:Stxbp1 UTSW 2 32802905 splice site probably benign
R0565:Stxbp1 UTSW 2 32819848 missense probably benign 0.07
R0617:Stxbp1 UTSW 2 32802783 missense probably damaging 1.00
R0690:Stxbp1 UTSW 2 32800695 splice site probably benign
R1022:Stxbp1 UTSW 2 32814967 splice site probably null
R1024:Stxbp1 UTSW 2 32814967 splice site probably null
R1295:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1296:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1472:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1699:Stxbp1 UTSW 2 32800617 missense probably damaging 0.99
R1744:Stxbp1 UTSW 2 32806719 critical splice donor site probably null
R2004:Stxbp1 UTSW 2 32798189 missense probably damaging 0.99
R2151:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R2153:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R2154:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R5170:Stxbp1 UTSW 2 32794674 missense probably benign 0.01
R6083:Stxbp1 UTSW 2 32796018 missense possibly damaging 0.95
R6295:Stxbp1 UTSW 2 32794609 missense probably damaging 0.98
R6504:Stxbp1 UTSW 2 32801883 missense possibly damaging 0.95
R6770:Stxbp1 UTSW 2 32819889 missense probably benign 0.01
R6954:Stxbp1 UTSW 2 32801893 missense probably damaging 0.99
R7283:Stxbp1 UTSW 2 32815014 missense probably damaging 1.00
R7382:Stxbp1 UTSW 2 32798168 missense probably damaging 1.00
R7541:Stxbp1 UTSW 2 32818505 missense probably damaging 0.99
R7734:Stxbp1 UTSW 2 32801820 missense probably benign 0.00
R8364:Stxbp1 UTSW 2 32806762 missense possibly damaging 0.72
R8462:Stxbp1 UTSW 2 32817281 splice site probably null
R9143:Stxbp1 UTSW 2 32798145 missense probably damaging 0.99
R9246:Stxbp1 UTSW 2 32789574 missense possibly damaging 0.85
R9267:Stxbp1 UTSW 2 32818505 missense probably damaging 1.00
R9501:Stxbp1 UTSW 2 32802813 missense probably benign 0.00
R9600:Stxbp1 UTSW 2 32811108 missense possibly damaging 0.80
X0060:Stxbp1 UTSW 2 32802768 missense probably damaging 1.00
Z1177:Stxbp1 UTSW 2 32802754 missense probably null 1.00
Z1177:Stxbp1 UTSW 2 32809128 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04