Incidental Mutation 'RF010:Stxbp1'
ID 603111
Institutional Source Beutler Lab
Gene Symbol Stxbp1
Ensembl Gene ENSMUSG00000026797
Gene Name syntaxin binding protein 1
Synonyms Munc-18a, Sxtbp1, N-sec1, nsec1, Munc18-1, Rb-sec1, Unc18h
Accession Numbers
Essential gene? Possibly essential (E-score: 0.635) question?
Stock # RF010 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 32677619-32737249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32711927 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 30 (V30A)
Ref Sequence ENSEMBL: ENSMUSP00000089051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050000] [ENSMUST00000077458] [ENSMUST00000208840]
AlphaFold O08599
Predicted Effect probably benign
Transcript: ENSMUST00000050000
AA Change: V30A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000052440
Gene: ENSMUSG00000026797
AA Change: V30A

DomainStartEndE-ValueType
Pfam:Sec1 28 582 9.8e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077458
AA Change: V30A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000089051
Gene: ENSMUSG00000026797
AA Change: V30A

DomainStartEndE-ValueType
Pfam:Sec1 29 581 2.8e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208840
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a syntaxin-binding protein. The encoded protein appears to play a role in release of neurotransmitters via regulation of syntaxin, a transmembrane attachment protein receptor. Mutations in this gene have been associated with infantile epileptic encephalopathy-4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit total loss of neurotransmitter secretion from synaptic vesicles throughout development and massive neuron apoptosis after initial synaptogenesis, leading to widespread neurodegeneration and complete neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,879,473 (GRCm39) probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Ankrd28 A G 14: 31,500,943 (GRCm39) I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 21,433,927 (GRCm39) probably null Het
Bend3 T A 10: 43,386,180 (GRCm39) F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,129,712 (GRCm39) probably benign Het
Camkv CGCTGCTGC CGC 9: 107,825,059 (GRCm39) probably benign Het
Cfap251 TCTCA T 5: 123,412,224 (GRCm39) probably benign Het
Chga GCA GCATCA 12: 102,527,662 (GRCm39) probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 96,030,278 (GRCm39) probably null Het
Cnot3 T C 7: 3,659,068 (GRCm39) V438A probably benign Het
Cntnap5c T A 17: 58,593,790 (GRCm39) W710R probably damaging Het
Dyrk1a A G 16: 94,478,422 (GRCm39) S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,602,075 (GRCm39) probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,981,149 (GRCm39) probably null Het
Fmn2 T A 1: 174,409,581 (GRCm39) S605T unknown Het
Gab3 TCT TCTGCT X: 74,043,617 (GRCm39) probably benign Het
Gabre GCTC GCTCCGTCTC X: 71,313,666 (GRCm39) probably benign Het
Gli3 A G 13: 15,900,954 (GRCm39) Y1447C probably damaging Het
Hibch T C 1: 52,952,891 (GRCm39) V297A probably benign Het
Ifi213 C G 1: 173,409,719 (GRCm39) D462H probably damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 92,925,597 (GRCm39) probably benign Het
Lpo A G 11: 87,711,928 (GRCm39) V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,136,799 (GRCm39) probably benign Het
Mapk9 A G 11: 49,745,083 (GRCm39) probably benign Het
Mep1a G A 17: 43,797,126 (GRCm39) H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myh3 AC ACTTCC 11: 66,977,185 (GRCm39) probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,458,065 (GRCm39) probably benign Het
Or10ag56 T A 2: 87,139,184 (GRCm39) V37E possibly damaging Het
Or14a259 T C 7: 86,012,594 (GRCm39) Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,101,890 (GRCm39) probably null Het
Pfkm T A 15: 98,027,674 (GRCm39) I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,325,920 (GRCm39) probably null Het
Polr1has CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 37,275,955 (GRCm39) probably benign Het
Prkce T C 17: 86,795,627 (GRCm39) V288A probably damaging Het
Pxmp4 A G 2: 154,434,183 (GRCm39) S93P probably damaging Het
Rfc4 T C 16: 22,946,232 (GRCm39) T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,694,351 (GRCm39) probably benign Het
Ryr3 G T 2: 112,606,015 (GRCm39) A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 24,164,325 (GRCm39) probably benign Het
Sec24c T A 14: 20,738,783 (GRCm39) probably null Het
Sec63 C A 10: 42,682,620 (GRCm39) A437E probably benign Het
Six3 GCG GCGTCG 17: 85,928,783 (GRCm39) probably benign Het
Slco5a1 G A 1: 12,942,171 (GRCm39) T825I probably damaging Het
Spmap2l CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,164,274 (GRCm39) probably benign Het
Stard8 GGA GGAAGA X: 98,110,123 (GRCm39) probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,635,083 (GRCm39) probably benign Het
Syne1 T A 10: 5,196,386 (GRCm39) D3882V possibly damaging Het
T A G 17: 8,660,540 (GRCm39) T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,825,384 (GRCm39) probably benign Het
Tcof1 CAG CAGAAG 18: 60,968,816 (GRCm39) probably benign Het
Tcstv5 A T 13: 120,411,582 (GRCm39) V8E probably benign Het
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Tfeb CAG CAGAAG 17: 48,097,032 (GRCm39) probably benign Het
Thumpd3 C T 6: 113,033,006 (GRCm39) A248V probably damaging Het
Tlcd4 T A 3: 121,022,533 (GRCm39) I103L probably benign Het
Tmem181a T C 17: 6,330,978 (GRCm39) probably null Het
Trim41 A T 11: 48,698,165 (GRCm39) H600Q probably damaging Het
Ttbk2 A T 2: 120,620,820 (GRCm39) C147* probably null Het
Ttll2 C T 17: 7,618,737 (GRCm39) A397T probably benign Het
Unc79 T A 12: 103,079,046 (GRCm39) L1737Q probably benign Het
Usp47 T A 7: 111,692,145 (GRCm39) V869E probably damaging Het
Vmn1r231 T A 17: 21,110,255 (GRCm39) Q220L probably damaging Het
Vmn2r26 C T 6: 124,016,448 (GRCm39) T304I possibly damaging Het
Wrn T C 8: 33,778,793 (GRCm39) N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,013,451 (GRCm39) probably benign Het
Zfyve26 C T 12: 79,302,112 (GRCm39) C1828Y probably damaging Het
Other mutations in Stxbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Stxbp1 APN 2 32,702,076 (GRCm39) missense probably benign 0.00
IGL02743:Stxbp1 APN 2 32,709,913 (GRCm39) missense probably damaging 0.98
volume UTSW 2 32,691,905 (GRCm39) missense probably damaging 0.99
volume2 UTSW 2 32,691,895 (GRCm39) missense possibly damaging 0.95
P0021:Stxbp1 UTSW 2 32,713,550 (GRCm39) missense probably damaging 0.96
R0217:Stxbp1 UTSW 2 32,691,882 (GRCm39) missense possibly damaging 0.69
R0269:Stxbp1 UTSW 2 32,692,795 (GRCm39) missense probably damaging 1.00
R0285:Stxbp1 UTSW 2 32,713,554 (GRCm39) missense probably benign 0.00
R0335:Stxbp1 UTSW 2 32,692,917 (GRCm39) splice site probably benign
R0565:Stxbp1 UTSW 2 32,709,860 (GRCm39) missense probably benign 0.07
R0617:Stxbp1 UTSW 2 32,692,795 (GRCm39) missense probably damaging 1.00
R0690:Stxbp1 UTSW 2 32,690,707 (GRCm39) splice site probably benign
R1022:Stxbp1 UTSW 2 32,704,979 (GRCm39) splice site probably null
R1024:Stxbp1 UTSW 2 32,704,979 (GRCm39) splice site probably null
R1295:Stxbp1 UTSW 2 32,684,648 (GRCm39) missense probably benign 0.18
R1296:Stxbp1 UTSW 2 32,684,648 (GRCm39) missense probably benign 0.18
R1472:Stxbp1 UTSW 2 32,684,648 (GRCm39) missense probably benign 0.18
R1699:Stxbp1 UTSW 2 32,690,629 (GRCm39) missense probably damaging 0.99
R1744:Stxbp1 UTSW 2 32,696,731 (GRCm39) critical splice donor site probably null
R2004:Stxbp1 UTSW 2 32,688,201 (GRCm39) missense probably damaging 0.99
R2151:Stxbp1 UTSW 2 32,692,868 (GRCm39) missense probably damaging 1.00
R2153:Stxbp1 UTSW 2 32,692,868 (GRCm39) missense probably damaging 1.00
R2154:Stxbp1 UTSW 2 32,692,868 (GRCm39) missense probably damaging 1.00
R5170:Stxbp1 UTSW 2 32,684,686 (GRCm39) missense probably benign 0.01
R6083:Stxbp1 UTSW 2 32,686,030 (GRCm39) missense possibly damaging 0.95
R6295:Stxbp1 UTSW 2 32,684,621 (GRCm39) missense probably damaging 0.98
R6504:Stxbp1 UTSW 2 32,691,895 (GRCm39) missense possibly damaging 0.95
R6770:Stxbp1 UTSW 2 32,709,901 (GRCm39) missense probably benign 0.01
R6954:Stxbp1 UTSW 2 32,691,905 (GRCm39) missense probably damaging 0.99
R7283:Stxbp1 UTSW 2 32,705,026 (GRCm39) missense probably damaging 1.00
R7382:Stxbp1 UTSW 2 32,688,180 (GRCm39) missense probably damaging 1.00
R7541:Stxbp1 UTSW 2 32,708,517 (GRCm39) missense probably damaging 0.99
R7734:Stxbp1 UTSW 2 32,691,832 (GRCm39) missense probably benign 0.00
R8364:Stxbp1 UTSW 2 32,696,774 (GRCm39) missense possibly damaging 0.72
R8462:Stxbp1 UTSW 2 32,707,293 (GRCm39) splice site probably null
R9143:Stxbp1 UTSW 2 32,688,157 (GRCm39) missense probably damaging 0.99
R9246:Stxbp1 UTSW 2 32,679,586 (GRCm39) missense possibly damaging 0.85
R9267:Stxbp1 UTSW 2 32,708,517 (GRCm39) missense probably damaging 1.00
R9501:Stxbp1 UTSW 2 32,692,825 (GRCm39) missense probably benign 0.00
R9600:Stxbp1 UTSW 2 32,701,120 (GRCm39) missense possibly damaging 0.80
X0060:Stxbp1 UTSW 2 32,692,780 (GRCm39) missense probably damaging 1.00
Z1177:Stxbp1 UTSW 2 32,699,140 (GRCm39) missense probably damaging 0.99
Z1177:Stxbp1 UTSW 2 32,692,766 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGCACTGCATTCTGTG -3'
(R):5'- GGCAGCAAACACTGTTGTCAG -3'

Sequencing Primer
(F):5'- AGGGCTTATCGTCTTACCACAGG -3'
(R):5'- ACTGTTGTCAGACGGTGAAG -3'
Posted On 2019-12-04