Incidental Mutation 'RF010:Acap3'
ID603122
Institutional Source Beutler Lab
Gene Symbol Acap3
Ensembl Gene ENSMUSG00000029033
Gene NameArfGAP with coiled-coil, ankyrin repeat and PH domains 3
SynonymsCentb5, Kiaa1716-hp
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #RF010 (G1)
Quality Score214.724
Status Not validated
Chromosome4
Chromosomal Location155891822-155907251 bp(+) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) CCTGGGCTGCTG to CCTGGGCTGCTGCATACTGGGCTGCTG at 155905096 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079031] [ENSMUST00000105584]
Predicted Effect probably benign
Transcript: ENSMUST00000079031
SMART Domains Protein: ENSMUSP00000078040
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
PH 265 361 6.35e-16 SMART
low complexity region 377 391 N/A INTRINSIC
ArfGap 399 521 4.62e-56 SMART
low complexity region 554 566 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 628 650 N/A INTRINSIC
low complexity region 669 686 N/A INTRINSIC
ANK 696 725 3.91e-3 SMART
ANK 729 758 2.43e1 SMART
low complexity region 781 796 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105584
SMART Domains Protein: ENSMUSP00000101209
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
Pfam:BAR_3 3 236 4.1e-95 PFAM
PH 269 365 6.35e-16 SMART
low complexity region 381 395 N/A INTRINSIC
ArfGap 403 525 4.62e-56 SMART
low complexity region 558 570 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 673 690 N/A INTRINSIC
ANK 700 729 3.91e-3 SMART
ANK 733 762 2.43e1 SMART
low complexity region 785 800 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,568,576 probably benign Het
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,762,175 probably null Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,627,584 probably benign Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 23,945,351 probably benign Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Acap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Acap3 APN 4 155902219 missense probably damaging 0.99
IGL01815:Acap3 APN 4 155902187 missense probably damaging 1.00
IGL02104:Acap3 APN 4 155905085 missense probably damaging 1.00
IGL02387:Acap3 APN 4 155902160 missense probably damaging 1.00
IGL02544:Acap3 APN 4 155892410 missense possibly damaging 0.93
IGL03124:Acap3 APN 4 155905033 missense probably benign 0.00
IGL03052:Acap3 UTSW 4 155903358 missense probably damaging 1.00
PIT4514001:Acap3 UTSW 4 155903378 missense probably benign 0.00
R0207:Acap3 UTSW 4 155899424 missense probably damaging 1.00
R0452:Acap3 UTSW 4 155902328 nonsense probably null
R1110:Acap3 UTSW 4 155905399 splice site probably null
R1387:Acap3 UTSW 4 155899480 missense probably benign 0.06
R1475:Acap3 UTSW 4 155902821 missense probably damaging 1.00
R1535:Acap3 UTSW 4 155896174 splice site probably benign
R2136:Acap3 UTSW 4 155896912 missense probably damaging 1.00
R2149:Acap3 UTSW 4 155905625 missense probably damaging 1.00
R2218:Acap3 UTSW 4 155903862 splice site probably null
R2897:Acap3 UTSW 4 155904931 splice site probably null
R2898:Acap3 UTSW 4 155903459 missense possibly damaging 0.88
R2898:Acap3 UTSW 4 155904931 splice site probably null
R3008:Acap3 UTSW 4 155905682 missense probably benign 0.37
R4170:Acap3 UTSW 4 155900001 missense possibly damaging 0.85
R4193:Acap3 UTSW 4 155901777 missense probably benign 0.07
R4822:Acap3 UTSW 4 155902451 intron probably benign
R4882:Acap3 UTSW 4 155905655 missense probably damaging 0.99
R5482:Acap3 UTSW 4 155900156 missense probably benign 0.00
R5655:Acap3 UTSW 4 155896619 missense probably benign 0.22
R5769:Acap3 UTSW 4 155902400 missense probably damaging 0.99
R5943:Acap3 UTSW 4 155899422 missense possibly damaging 0.78
R6236:Acap3 UTSW 4 155905207 missense possibly damaging 0.91
R6259:Acap3 UTSW 4 155896118 missense possibly damaging 0.91
R6790:Acap3 UTSW 4 155902991 missense probably damaging 1.00
R7000:Acap3 UTSW 4 155903849 missense possibly damaging 0.79
R7352:Acap3 UTSW 4 155905711 missense possibly damaging 0.56
R7442:Acap3 UTSW 4 155905621 missense probably damaging 0.98
RF008:Acap3 UTSW 4 155905098 small insertion probably benign
RF013:Acap3 UTSW 4 155905096 small insertion probably benign
RF022:Acap3 UTSW 4 155905096 small insertion probably benign
RF025:Acap3 UTSW 4 155905102 small insertion probably benign
RF028:Acap3 UTSW 4 155905091 small insertion probably benign
RF032:Acap3 UTSW 4 155905102 small insertion probably benign
RF034:Acap3 UTSW 4 155905092 small insertion probably benign
RF035:Acap3 UTSW 4 155905091 small insertion probably benign
RF036:Acap3 UTSW 4 155905087 small insertion probably benign
RF038:Acap3 UTSW 4 155905092 small insertion probably benign
RF039:Acap3 UTSW 4 155905092 small insertion probably benign
RF041:Acap3 UTSW 4 155905100 small insertion probably benign
RF064:Acap3 UTSW 4 155905100 small insertion probably benign
Z1176:Acap3 UTSW 4 155905179 missense probably damaging 1.00
Z1177:Acap3 UTSW 4 155905518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATGTTCTTGCCTTCGG -3'
(R):5'- ACACGTAGGTATGCAGTCTTG -3'

Sequencing Primer
(F):5'- AGTGGTGGACAGTGTCACC -3'
(R):5'- GTTTTTCATATAAGCCCTGCCTGTG -3'
Posted On2019-12-04