Incidental Mutation 'RF010:Thegl'
ID603123
Institutional Source Beutler Lab
Gene Symbol Thegl
Ensembl Gene ENSMUSG00000029248
Gene Nametheg spermatid protein like
Synonyms1700023E05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #RF010 (G1)
Quality Score217.468
Status Not validated
Chromosome5
Chromosomal Location77016023-77061529 bp(+) (GRCm38)
Type of Mutationsmall insertion (9 aa in frame mutation)
DNA Base Change (assembly) CAG to CAGCGATCCTCCCCAGTCCCGCAAGGCGAG at 77016427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031161] [ENSMUST00000117880]
Predicted Effect probably benign
Transcript: ENSMUST00000031161
SMART Domains Protein: ENSMUSP00000031161
Gene: ENSMUSG00000029248

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117880
SMART Domains Protein: ENSMUSP00000112814
Gene: ENSMUSG00000029248

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,568,576 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,762,175 probably null Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,627,584 probably benign Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 23,945,351 probably benign Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Thegl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Thegl APN 5 77060831 missense probably damaging 1.00
IGL02008:Thegl APN 5 77060758 missense probably benign 0.01
IGL02014:Thegl APN 5 77047155 missense probably damaging 0.99
IGL02525:Thegl APN 5 77016553 missense probably benign 0.08
IGL03036:Thegl APN 5 77016350 missense possibly damaging 0.86
IGL03200:Thegl APN 5 77060864 missense possibly damaging 0.66
IGL03302:Thegl APN 5 77054576 missense probably benign 0.09
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0483:Thegl UTSW 5 77037357 splice site probably benign
R1875:Thegl UTSW 5 77054584 missense probably benign 0.29
R2121:Thegl UTSW 5 77060758 missense probably benign 0.01
R2232:Thegl UTSW 5 77059405 missense possibly damaging 0.84
R2280:Thegl UTSW 5 77059367 missense probably damaging 1.00
R2281:Thegl UTSW 5 77059367 missense probably damaging 1.00
R4422:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4423:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4424:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4935:Thegl UTSW 5 77037353 critical splice donor site probably null
R5041:Thegl UTSW 5 77056081 missense probably benign 0.05
R5175:Thegl UTSW 5 77016470 missense probably benign 0.00
R5560:Thegl UTSW 5 77016486 missense possibly damaging 0.61
R6086:Thegl UTSW 5 77061305 missense probably benign 0.11
R6193:Thegl UTSW 5 77016336 missense possibly damaging 0.85
R7070:Thegl UTSW 5 77047277 critical splice donor site probably null
R7453:Thegl UTSW 5 77060786 missense probably damaging 1.00
R7703:Thegl UTSW 5 77016597 missense probably benign 0.34
RF007:Thegl UTSW 5 77016408 small insertion probably benign
RF014:Thegl UTSW 5 77016400 small insertion probably benign
RF016:Thegl UTSW 5 77016408 small insertion probably benign
RF020:Thegl UTSW 5 77016400 small insertion probably benign
RF028:Thegl UTSW 5 77016401 small insertion probably benign
RF030:Thegl UTSW 5 77016401 small insertion probably benign
RF031:Thegl UTSW 5 77016410 small insertion probably benign
RF033:Thegl UTSW 5 77016405 small insertion probably benign
RF033:Thegl UTSW 5 77016429 small insertion probably benign
RF036:Thegl UTSW 5 77016429 small insertion probably benign
RF037:Thegl UTSW 5 77016421 small insertion probably benign
RF039:Thegl UTSW 5 77016402 small insertion probably benign
RF044:Thegl UTSW 5 77016405 small insertion probably benign
RF046:Thegl UTSW 5 77016403 small insertion probably benign
RF055:Thegl UTSW 5 77016403 small insertion probably benign
RF060:Thegl UTSW 5 77016427 small insertion probably benign
RF063:Thegl UTSW 5 77016426 small insertion probably benign
RF064:Thegl UTSW 5 77016415 small insertion probably benign
Z1176:Thegl UTSW 5 77060794 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCTCAGGTTCATCCGTGCG -3'
(R):5'- TCTGGCTATCAAAGATGGGGAG -3'

Sequencing Primer
(F):5'- TTCATCCGTGCGATCCGAG -3'
(R):5'- GGTCATAATCACTGCGTTGGGAAAC -3'
Posted On2019-12-04