Incidental Mutation 'RF010:Thumpd3'
ID 603125
Institutional Source Beutler Lab
Gene Symbol Thumpd3
Ensembl Gene ENSMUSG00000030264
Gene Name THUMP domain containing 3
Synonyms Gtrosa26as
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.375) question?
Stock # RF010 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 113023292-113045239 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 113033006 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 248 (A248V)
Ref Sequence ENSEMBL: ENSMUSP00000032398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032398] [ENSMUST00000155378]
AlphaFold P97770
Predicted Effect probably damaging
Transcript: ENSMUST00000032398
AA Change: A248V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032398
Gene: ENSMUSG00000030264
AA Change: A248V

DomainStartEndE-ValueType
low complexity region 142 151 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
THUMP 190 287 4.75e-12 SMART
Pfam:UPF0020 294 480 1.2e-57 PFAM
Pfam:Methyltransf_26 322 449 6.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155378
SMART Domains Protein: ENSMUSP00000120509
Gene: ENSMUSG00000030264

DomainStartEndE-ValueType
low complexity region 142 151 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
Blast:THUMP 190 222 2e-13 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,879,473 (GRCm39) probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Ankrd28 A G 14: 31,500,943 (GRCm39) I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 21,433,927 (GRCm39) probably null Het
Bend3 T A 10: 43,386,180 (GRCm39) F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,129,712 (GRCm39) probably benign Het
Camkv CGCTGCTGC CGC 9: 107,825,059 (GRCm39) probably benign Het
Cfap251 TCTCA T 5: 123,412,224 (GRCm39) probably benign Het
Chga GCA GCATCA 12: 102,527,662 (GRCm39) probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 96,030,278 (GRCm39) probably null Het
Cnot3 T C 7: 3,659,068 (GRCm39) V438A probably benign Het
Cntnap5c T A 17: 58,593,790 (GRCm39) W710R probably damaging Het
Dyrk1a A G 16: 94,478,422 (GRCm39) S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,602,075 (GRCm39) probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,981,149 (GRCm39) probably null Het
Fmn2 T A 1: 174,409,581 (GRCm39) S605T unknown Het
Gab3 TCT TCTGCT X: 74,043,617 (GRCm39) probably benign Het
Gabre GCTC GCTCCGTCTC X: 71,313,666 (GRCm39) probably benign Het
Gli3 A G 13: 15,900,954 (GRCm39) Y1447C probably damaging Het
Hibch T C 1: 52,952,891 (GRCm39) V297A probably benign Het
Ifi213 C G 1: 173,409,719 (GRCm39) D462H probably damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 92,925,597 (GRCm39) probably benign Het
Lpo A G 11: 87,711,928 (GRCm39) V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,136,799 (GRCm39) probably benign Het
Mapk9 A G 11: 49,745,083 (GRCm39) probably benign Het
Mep1a G A 17: 43,797,126 (GRCm39) H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myh3 AC ACTTCC 11: 66,977,185 (GRCm39) probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,458,065 (GRCm39) probably benign Het
Or10ag56 T A 2: 87,139,184 (GRCm39) V37E possibly damaging Het
Or14a259 T C 7: 86,012,594 (GRCm39) Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,101,890 (GRCm39) probably null Het
Pfkm T A 15: 98,027,674 (GRCm39) I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,325,920 (GRCm39) probably null Het
Polr1has CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 37,275,955 (GRCm39) probably benign Het
Prkce T C 17: 86,795,627 (GRCm39) V288A probably damaging Het
Pxmp4 A G 2: 154,434,183 (GRCm39) S93P probably damaging Het
Rfc4 T C 16: 22,946,232 (GRCm39) T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,694,351 (GRCm39) probably benign Het
Ryr3 G T 2: 112,606,015 (GRCm39) A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 24,164,325 (GRCm39) probably benign Het
Sec24c T A 14: 20,738,783 (GRCm39) probably null Het
Sec63 C A 10: 42,682,620 (GRCm39) A437E probably benign Het
Six3 GCG GCGTCG 17: 85,928,783 (GRCm39) probably benign Het
Slco5a1 G A 1: 12,942,171 (GRCm39) T825I probably damaging Het
Spmap2l CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,164,274 (GRCm39) probably benign Het
Stard8 GGA GGAAGA X: 98,110,123 (GRCm39) probably benign Het
Stxbp1 A G 2: 32,711,927 (GRCm39) V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,635,083 (GRCm39) probably benign Het
Syne1 T A 10: 5,196,386 (GRCm39) D3882V possibly damaging Het
T A G 17: 8,660,540 (GRCm39) T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,825,384 (GRCm39) probably benign Het
Tcof1 CAG CAGAAG 18: 60,968,816 (GRCm39) probably benign Het
Tcstv5 A T 13: 120,411,582 (GRCm39) V8E probably benign Het
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Tfeb CAG CAGAAG 17: 48,097,032 (GRCm39) probably benign Het
Tlcd4 T A 3: 121,022,533 (GRCm39) I103L probably benign Het
Tmem181a T C 17: 6,330,978 (GRCm39) probably null Het
Trim41 A T 11: 48,698,165 (GRCm39) H600Q probably damaging Het
Ttbk2 A T 2: 120,620,820 (GRCm39) C147* probably null Het
Ttll2 C T 17: 7,618,737 (GRCm39) A397T probably benign Het
Unc79 T A 12: 103,079,046 (GRCm39) L1737Q probably benign Het
Usp47 T A 7: 111,692,145 (GRCm39) V869E probably damaging Het
Vmn1r231 T A 17: 21,110,255 (GRCm39) Q220L probably damaging Het
Vmn2r26 C T 6: 124,016,448 (GRCm39) T304I possibly damaging Het
Wrn T C 8: 33,778,793 (GRCm39) N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,013,451 (GRCm39) probably benign Het
Zfyve26 C T 12: 79,302,112 (GRCm39) C1828Y probably damaging Het
Other mutations in Thumpd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Thumpd3 APN 6 113,024,622 (GRCm39) missense possibly damaging 0.94
IGL01113:Thumpd3 APN 6 113,037,021 (GRCm39) missense probably benign 0.36
IGL01525:Thumpd3 APN 6 113,024,597 (GRCm39) missense probably damaging 1.00
IGL01560:Thumpd3 APN 6 113,040,120 (GRCm39) missense possibly damaging 0.88
IGL01734:Thumpd3 APN 6 113,043,806 (GRCm39) missense probably damaging 1.00
IGL01814:Thumpd3 APN 6 113,040,112 (GRCm39) missense possibly damaging 0.64
IGL01901:Thumpd3 APN 6 113,036,932 (GRCm39) missense probably benign 0.09
IGL01977:Thumpd3 APN 6 113,036,927 (GRCm39) missense possibly damaging 0.96
IGL02697:Thumpd3 APN 6 113,044,256 (GRCm39) missense probably benign 0.03
IGL02805:Thumpd3 APN 6 113,043,758 (GRCm39) missense probably damaging 1.00
PIT4431001:Thumpd3 UTSW 6 113,036,939 (GRCm39) missense probably benign 0.01
R0139:Thumpd3 UTSW 6 113,044,762 (GRCm39) missense probably benign 0.00
R0386:Thumpd3 UTSW 6 113,042,621 (GRCm39) critical splice donor site probably null
R1975:Thumpd3 UTSW 6 113,032,838 (GRCm39) missense possibly damaging 0.92
R2125:Thumpd3 UTSW 6 113,043,749 (GRCm39) missense probably benign 0.02
R3709:Thumpd3 UTSW 6 113,032,652 (GRCm39) missense possibly damaging 0.65
R5439:Thumpd3 UTSW 6 113,043,825 (GRCm39) splice site silent
R6074:Thumpd3 UTSW 6 113,036,971 (GRCm39) missense possibly damaging 0.70
R6406:Thumpd3 UTSW 6 113,032,924 (GRCm39) missense probably damaging 0.98
R7411:Thumpd3 UTSW 6 113,033,072 (GRCm39) missense possibly damaging 0.92
R7464:Thumpd3 UTSW 6 113,032,730 (GRCm39) missense probably benign 0.00
R7465:Thumpd3 UTSW 6 113,024,592 (GRCm39) missense probably damaging 1.00
R7779:Thumpd3 UTSW 6 113,036,950 (GRCm39) missense probably damaging 0.98
R8319:Thumpd3 UTSW 6 113,040,107 (GRCm39) nonsense probably null
R9268:Thumpd3 UTSW 6 113,043,819 (GRCm39) missense probably damaging 1.00
R9695:Thumpd3 UTSW 6 113,024,622 (GRCm39) missense possibly damaging 0.93
Z1088:Thumpd3 UTSW 6 113,032,991 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGACTATTATGAAAATCCAGCCATC -3'
(R):5'- CTGTTCAATGGCCCTTGTGC -3'

Sequencing Primer
(F):5'- TTATGAAAATCCAGCCATCAAAGAAG -3'
(R):5'- AGTCTCTCACTGAACCTGGG -3'
Posted On 2019-12-04