Incidental Mutation 'RF010:Cnot3'
ID603129
Institutional Source Beutler Lab
Gene Symbol Cnot3
Ensembl Gene ENSMUSG00000035632
Gene NameCCR4-NOT transcription complex, subunit 3
SynonymsA930039N10Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF010 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location3645268-3661109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3656069 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 438 (V438A)
Ref Sequence ENSEMBL: ENSMUSP00000039098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019878] [ENSMUST00000038913] [ENSMUST00000160200] [ENSMUST00000206287]
Predicted Effect probably benign
Transcript: ENSMUST00000019878
SMART Domains Protein: ENSMUSP00000019878
Gene: ENSMUSG00000078813

DomainStartEndE-ValueType
Cir_N 8 44 2.43e-9 SMART
low complexity region 94 109 N/A INTRINSIC
low complexity region 171 192 N/A INTRINSIC
coiled coil region 198 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038913
AA Change: V438A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000039098
Gene: ENSMUSG00000035632
AA Change: V438A

DomainStartEndE-ValueType
Pfam:Not3 3 232 6.5e-99 PFAM
low complexity region 257 274 N/A INTRINSIC
low complexity region 316 338 N/A INTRINSIC
low complexity region 384 426 N/A INTRINSIC
low complexity region 441 450 N/A INTRINSIC
low complexity region 473 509 N/A INTRINSIC
low complexity region 570 587 N/A INTRINSIC
Pfam:NOT2_3_5 618 745 3.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132344
SMART Domains Protein: ENSMUSP00000117297
Gene: ENSMUSG00000035632

DomainStartEndE-ValueType
Pfam:Not3 1 189 8.9e-77 PFAM
low complexity region 214 231 N/A INTRINSIC
SCOP:d1cpo_2 260 335 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135977
SMART Domains Protein: ENSMUSP00000118822
Gene: ENSMUSG00000035632

DomainStartEndE-ValueType
Pfam:Not3 1 78 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160200
SMART Domains Protein: ENSMUSP00000124810
Gene: ENSMUSG00000035632

DomainStartEndE-ValueType
Pfam:NOT2_3_5 1 83 3.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206287
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show defective outgrowth of the inner cell mass and complete embryonic lethality at implantation. Heterozygotes exhibit decreased cardiac muscle contractility and develop severe cardiomyopathy leading to heart failure in response to pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,568,576 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,762,175 probably null Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,627,584 probably benign Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 23,945,351 probably benign Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Cnot3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cnot3 APN 7 3650855 missense probably damaging 1.00
IGL02231:Cnot3 APN 7 3658210 missense probably benign 0.00
IGL02476:Cnot3 APN 7 3658068 missense probably benign 0.01
IGL03102:Cnot3 APN 7 3656156 nonsense probably null
IGL03181:Cnot3 APN 7 3653248 missense probably damaging 1.00
secondary UTSW 7 3651919 missense probably damaging 1.00
R4531:Cnot3 UTSW 7 3658074 missense probably benign
R4564:Cnot3 UTSW 7 3653258 missense probably damaging 1.00
R5071:Cnot3 UTSW 7 3650861 missense probably damaging 1.00
R5649:Cnot3 UTSW 7 3658083 missense probably benign 0.08
R5869:Cnot3 UTSW 7 3644930 unclassified probably benign
R6120:Cnot3 UTSW 7 3645336 splice site probably null
R6759:Cnot3 UTSW 7 3651919 missense probably damaging 1.00
R7305:Cnot3 UTSW 7 3645480 start gained probably benign
R7369:Cnot3 UTSW 7 3653331 missense possibly damaging 0.77
R7860:Cnot3 UTSW 7 3655566 splice site probably null
R7957:Cnot3 UTSW 7 3658222 missense probably benign
R8172:Cnot3 UTSW 7 3658725 missense possibly damaging 0.64
R8415:Cnot3 UTSW 7 3658688 missense probably benign 0.01
Z1177:Cnot3 UTSW 7 3651495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTAACAGTGGCACAGGCG -3'
(R):5'- CCACTTGGTAAGAAGCAGGG -3'

Sequencing Primer
(F):5'- GTGGCACAGGCGGAGGG -3'
(R):5'- AGGACACACTGGGTAGGTAC -3'
Posted On2019-12-04