Incidental Mutation 'RF010:Olfr305'
ID603131
Institutional Source Beutler Lab
Gene Symbol Olfr305
Ensembl Gene ENSMUSG00000055571
Gene Nameolfactory receptor 305
SynonymsMOR219-2, GA_x6K02T2NHDJ-9744055-9745014
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #RF010 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86360854-86366928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86363386 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 317 (Q317R)
Ref Sequence ENSEMBL: ENSMUSP00000149762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069236] [ENSMUST00000213255] [ENSMUST00000213869] [ENSMUST00000216700]
Predicted Effect probably benign
Transcript: ENSMUST00000069236
AA Change: Q317R

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000068650
Gene: ENSMUSG00000055571
AA Change: Q317R

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-40 PFAM
Pfam:7tm_1 39 288 3.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213255
AA Change: Q317R

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000213869
AA Change: Q317R

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000216700
AA Change: Q317R

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,568,576 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,762,175 probably null Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,627,584 probably benign Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 23,945,351 probably benign Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Olfr305
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Olfr305 APN 7 86363560 missense possibly damaging 0.46
IGL02102:Olfr305 APN 7 86363866 missense probably benign 0.25
IGL02424:Olfr305 APN 7 86363480 missense probably benign 0.02
IGL02664:Olfr305 APN 7 86363603 missense possibly damaging 0.94
IGL03167:Olfr305 APN 7 86363920 missense probably damaging 1.00
R0035:Olfr305 UTSW 7 86364187 missense possibly damaging 0.95
R0373:Olfr305 UTSW 7 86363805 nonsense probably null
R0510:Olfr305 UTSW 7 86363827 missense probably benign 0.21
R2214:Olfr305 UTSW 7 86364206 missense probably benign 0.01
R3147:Olfr305 UTSW 7 86363884 missense probably benign 0.01
R3623:Olfr305 UTSW 7 86364100 missense probably benign 0.02
R4155:Olfr305 UTSW 7 86364062 missense probably benign 0.00
R4332:Olfr305 UTSW 7 86363872 missense probably benign 0.01
R4785:Olfr305 UTSW 7 86363735 missense probably damaging 1.00
R4834:Olfr305 UTSW 7 86363744 missense probably benign 0.21
R4871:Olfr305 UTSW 7 86363484 missense probably damaging 1.00
R5161:Olfr305 UTSW 7 86364338 splice site probably null
R5254:Olfr305 UTSW 7 86364190 missense possibly damaging 0.82
R6430:Olfr305 UTSW 7 86363973 nonsense probably null
R7734:Olfr305 UTSW 7 86364268 missense not run
Predicted Primers PCR Primer
(F):5'- TGGCAGAATCTCATAGAAATCAGGG -3'
(R):5'- GCATTTGGCACCTGTATCCC -3'

Sequencing Primer
(F):5'- GAATCTCATAGAAATCAGGGTGAATC -3'
(R):5'- GTCTATCTGAAGCCACCCTCAAATTC -3'
Posted On2019-12-04