Incidental Mutation 'RF010:Cngb1'
ID 603135
Institutional Source Beutler Lab
Gene Symbol Cngb1
Ensembl Gene ENSMUSG00000031789
Gene Name cyclic nucleotide gated channel beta 1
Synonyms Cngb1b, BC016201, Cngb1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF010 (G1)
Quality Score 136.467
Status Not validated
Chromosome 8
Chromosomal Location 95965673-96033213 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CTCTGGCTCTGGCTCTGGCTCTG to C at 96030278 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093268] [ENSMUST00000119870] [ENSMUST00000133716] [ENSMUST00000134207] [ENSMUST00000156514]
AlphaFold E1AZ71
Predicted Effect probably null
Transcript: ENSMUST00000093268
SMART Domains Protein: ENSMUSP00000090956
Gene: ENSMUSG00000031789

DomainStartEndE-ValueType
low complexity region 33 103 N/A INTRINSIC
low complexity region 248 267 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119870
SMART Domains Protein: ENSMUSP00000113827
Gene: ENSMUSG00000031789

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
Pfam:Ion_trans 83 315 9.8e-17 PFAM
cNMP 389 508 4.1e-25 SMART
low complexity region 555 596 N/A INTRINSIC
low complexity region 599 636 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000133716
Predicted Effect probably null
Transcript: ENSMUST00000134207
Predicted Effect probably null
Transcript: ENSMUST00000156514
Predicted Effect probably benign
Transcript: ENSMUST00000212237
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display postnatal lethality, reduced body size and weight, and retinal rod degeneration followed by cone degeneration. Mice homozygous for an allele lacking the calmodulin-binding domain exhibit defective olfactory neural signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,879,473 (GRCm39) probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Ankrd28 A G 14: 31,500,943 (GRCm39) I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 21,433,927 (GRCm39) probably null Het
Bend3 T A 10: 43,386,180 (GRCm39) F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,129,712 (GRCm39) probably benign Het
Camkv CGCTGCTGC CGC 9: 107,825,059 (GRCm39) probably benign Het
Cfap251 TCTCA T 5: 123,412,224 (GRCm39) probably benign Het
Chga GCA GCATCA 12: 102,527,662 (GRCm39) probably benign Het
Cnot3 T C 7: 3,659,068 (GRCm39) V438A probably benign Het
Cntnap5c T A 17: 58,593,790 (GRCm39) W710R probably damaging Het
Dyrk1a A G 16: 94,478,422 (GRCm39) S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,602,075 (GRCm39) probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,981,149 (GRCm39) probably null Het
Fmn2 T A 1: 174,409,581 (GRCm39) S605T unknown Het
Gab3 TCT TCTGCT X: 74,043,617 (GRCm39) probably benign Het
Gabre GCTC GCTCCGTCTC X: 71,313,666 (GRCm39) probably benign Het
Gli3 A G 13: 15,900,954 (GRCm39) Y1447C probably damaging Het
Hibch T C 1: 52,952,891 (GRCm39) V297A probably benign Het
Ifi213 C G 1: 173,409,719 (GRCm39) D462H probably damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 92,925,597 (GRCm39) probably benign Het
Lpo A G 11: 87,711,928 (GRCm39) V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,136,799 (GRCm39) probably benign Het
Mapk9 A G 11: 49,745,083 (GRCm39) probably benign Het
Mep1a G A 17: 43,797,126 (GRCm39) H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myh3 AC ACTTCC 11: 66,977,185 (GRCm39) probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,458,065 (GRCm39) probably benign Het
Or10ag56 T A 2: 87,139,184 (GRCm39) V37E possibly damaging Het
Or14a259 T C 7: 86,012,594 (GRCm39) Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,101,890 (GRCm39) probably null Het
Pfkm T A 15: 98,027,674 (GRCm39) I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,325,920 (GRCm39) probably null Het
Polr1has CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 37,275,955 (GRCm39) probably benign Het
Prkce T C 17: 86,795,627 (GRCm39) V288A probably damaging Het
Pxmp4 A G 2: 154,434,183 (GRCm39) S93P probably damaging Het
Rfc4 T C 16: 22,946,232 (GRCm39) T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,694,351 (GRCm39) probably benign Het
Ryr3 G T 2: 112,606,015 (GRCm39) A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 24,164,325 (GRCm39) probably benign Het
Sec24c T A 14: 20,738,783 (GRCm39) probably null Het
Sec63 C A 10: 42,682,620 (GRCm39) A437E probably benign Het
Six3 GCG GCGTCG 17: 85,928,783 (GRCm39) probably benign Het
Slco5a1 G A 1: 12,942,171 (GRCm39) T825I probably damaging Het
Spmap2l CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,164,274 (GRCm39) probably benign Het
Stard8 GGA GGAAGA X: 98,110,123 (GRCm39) probably benign Het
Stxbp1 A G 2: 32,711,927 (GRCm39) V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,635,083 (GRCm39) probably benign Het
Syne1 T A 10: 5,196,386 (GRCm39) D3882V possibly damaging Het
T A G 17: 8,660,540 (GRCm39) T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,825,384 (GRCm39) probably benign Het
Tcof1 CAG CAGAAG 18: 60,968,816 (GRCm39) probably benign Het
Tcstv5 A T 13: 120,411,582 (GRCm39) V8E probably benign Het
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Tfeb CAG CAGAAG 17: 48,097,032 (GRCm39) probably benign Het
Thumpd3 C T 6: 113,033,006 (GRCm39) A248V probably damaging Het
Tlcd4 T A 3: 121,022,533 (GRCm39) I103L probably benign Het
Tmem181a T C 17: 6,330,978 (GRCm39) probably null Het
Trim41 A T 11: 48,698,165 (GRCm39) H600Q probably damaging Het
Ttbk2 A T 2: 120,620,820 (GRCm39) C147* probably null Het
Ttll2 C T 17: 7,618,737 (GRCm39) A397T probably benign Het
Unc79 T A 12: 103,079,046 (GRCm39) L1737Q probably benign Het
Usp47 T A 7: 111,692,145 (GRCm39) V869E probably damaging Het
Vmn1r231 T A 17: 21,110,255 (GRCm39) Q220L probably damaging Het
Vmn2r26 C T 6: 124,016,448 (GRCm39) T304I possibly damaging Het
Wrn T C 8: 33,778,793 (GRCm39) N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,013,451 (GRCm39) probably benign Het
Zfyve26 C T 12: 79,302,112 (GRCm39) C1828Y probably damaging Het
Other mutations in Cngb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cngb1 APN 8 95,968,812 (GRCm39) splice site probably benign
IGL01575:Cngb1 APN 8 95,991,148 (GRCm39) missense possibly damaging 0.51
IGL02329:Cngb1 APN 8 95,968,987 (GRCm39) missense probably benign 0.14
IGL03332:Cngb1 APN 8 96,025,474 (GRCm39) splice site probably benign
IGL03391:Cngb1 APN 8 96,030,333 (GRCm39) unclassified probably benign
stevie UTSW 8 95,986,758 (GRCm39) missense probably damaging 1.00
swannie UTSW 8 96,023,756 (GRCm39) critical splice acceptor site probably null
R0078:Cngb1 UTSW 8 95,991,173 (GRCm39) critical splice acceptor site probably null
R0116:Cngb1 UTSW 8 95,987,266 (GRCm39) missense probably damaging 1.00
R1073:Cngb1 UTSW 8 96,030,195 (GRCm39) critical splice donor site probably null
R1166:Cngb1 UTSW 8 95,986,809 (GRCm39) missense probably damaging 0.99
R1714:Cngb1 UTSW 8 95,984,559 (GRCm39) missense probably damaging 1.00
R1753:Cngb1 UTSW 8 96,024,401 (GRCm39) critical splice donor site probably benign
R1760:Cngb1 UTSW 8 96,026,328 (GRCm39) missense probably benign 0.03
R1833:Cngb1 UTSW 8 95,968,983 (GRCm39) missense probably damaging 1.00
R1935:Cngb1 UTSW 8 96,026,320 (GRCm39) missense probably damaging 1.00
R1939:Cngb1 UTSW 8 96,026,320 (GRCm39) missense probably damaging 1.00
R1940:Cngb1 UTSW 8 96,026,320 (GRCm39) missense probably damaging 1.00
R2045:Cngb1 UTSW 8 96,023,713 (GRCm39) splice site probably null
R2379:Cngb1 UTSW 8 95,986,758 (GRCm39) missense probably damaging 1.00
R2940:Cngb1 UTSW 8 95,978,735 (GRCm39) missense probably benign 0.44
R4034:Cngb1 UTSW 8 95,991,078 (GRCm39) missense possibly damaging 0.47
R4058:Cngb1 UTSW 8 95,994,282 (GRCm39) missense probably benign 0.00
R4425:Cngb1 UTSW 8 96,026,344 (GRCm39) missense probably damaging 1.00
R4585:Cngb1 UTSW 8 96,023,756 (GRCm39) critical splice acceptor site probably null
R4591:Cngb1 UTSW 8 95,980,012 (GRCm39) missense probably damaging 1.00
R4638:Cngb1 UTSW 8 95,992,647 (GRCm39) missense probably damaging 1.00
R4906:Cngb1 UTSW 8 95,978,601 (GRCm39) missense probably damaging 0.96
R4950:Cngb1 UTSW 8 95,975,135 (GRCm39) missense probably damaging 1.00
R4979:Cngb1 UTSW 8 95,985,785 (GRCm39) missense probably damaging 0.99
R5148:Cngb1 UTSW 8 95,992,611 (GRCm39) missense probably benign 0.28
R5474:Cngb1 UTSW 8 95,978,597 (GRCm39) missense probably damaging 1.00
R5475:Cngb1 UTSW 8 95,978,597 (GRCm39) missense probably damaging 1.00
R5545:Cngb1 UTSW 8 95,978,801 (GRCm39) missense
R5585:Cngb1 UTSW 8 95,989,767 (GRCm39) missense probably damaging 1.00
R5637:Cngb1 UTSW 8 95,984,549 (GRCm39) missense probably damaging 1.00
R5785:Cngb1 UTSW 8 95,980,823 (GRCm39) missense possibly damaging 0.90
R5967:Cngb1 UTSW 8 95,978,534 (GRCm39) missense probably damaging 1.00
R6013:Cngb1 UTSW 8 96,010,949 (GRCm39) unclassified probably benign
R6049:Cngb1 UTSW 8 95,997,470 (GRCm39) missense probably damaging 0.99
R6370:Cngb1 UTSW 8 95,991,050 (GRCm39) missense probably benign 0.33
R6377:Cngb1 UTSW 8 95,975,608 (GRCm39) missense probably damaging 1.00
R6401:Cngb1 UTSW 8 96,030,367 (GRCm39) unclassified probably benign
R6427:Cngb1 UTSW 8 96,024,387 (GRCm39) intron probably benign
R6492:Cngb1 UTSW 8 95,991,052 (GRCm39) missense probably benign 0.01
R6613:Cngb1 UTSW 8 95,992,638 (GRCm39) missense possibly damaging 0.95
R6721:Cngb1 UTSW 8 95,997,516 (GRCm39) missense probably benign 0.05
R6919:Cngb1 UTSW 8 95,975,003 (GRCm39) missense probably null 1.00
R7012:Cngb1 UTSW 8 95,984,583 (GRCm39) missense possibly damaging 0.83
R7418:Cngb1 UTSW 8 96,004,887 (GRCm39) nonsense probably null
R7464:Cngb1 UTSW 8 95,980,811 (GRCm39) missense possibly damaging 0.92
R7806:Cngb1 UTSW 8 96,025,432 (GRCm39) critical splice donor site probably null
R8048:Cngb1 UTSW 8 95,989,838 (GRCm39) missense possibly damaging 0.90
R8074:Cngb1 UTSW 8 95,978,801 (GRCm39) missense
R8189:Cngb1 UTSW 8 96,030,248 (GRCm39) unclassified probably benign
R8245:Cngb1 UTSW 8 96,024,408 (GRCm39) missense unknown
R8286:Cngb1 UTSW 8 96,002,252 (GRCm39) missense
R8819:Cngb1 UTSW 8 95,980,037 (GRCm39) critical splice acceptor site probably null
R8906:Cngb1 UTSW 8 95,989,736 (GRCm39) missense probably damaging 1.00
R8979:Cngb1 UTSW 8 96,004,913 (GRCm39) start gained probably benign
R9075:Cngb1 UTSW 8 95,979,993 (GRCm39) missense probably damaging 1.00
R9131:Cngb1 UTSW 8 95,979,893 (GRCm39) missense probably benign 0.02
R9311:Cngb1 UTSW 8 96,010,794 (GRCm39) critical splice donor site probably null
R9375:Cngb1 UTSW 8 96,026,350 (GRCm39) missense unknown
R9745:Cngb1 UTSW 8 95,967,919 (GRCm39) missense unknown
R9773:Cngb1 UTSW 8 95,975,042 (GRCm39) missense probably damaging 1.00
RF053:Cngb1 UTSW 8 96,030,276 (GRCm39) frame shift probably null
T0722:Cngb1 UTSW 8 96,024,447 (GRCm39) missense probably damaging 0.99
T0722:Cngb1 UTSW 8 96,023,278 (GRCm39) missense probably benign 0.02
T0722:Cngb1 UTSW 8 96,030,342 (GRCm39) unclassified probably benign
T0722:Cngb1 UTSW 8 96,030,324 (GRCm39) unclassified probably benign
Z1177:Cngb1 UTSW 8 95,978,764 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGACCACATTTCCCACTG -3'
(R):5'- AGACTATGTTGCTTACAGGTGTC -3'

Sequencing Primer
(F):5'- ACATTTCCCACTGGCCCC -3'
(R):5'- TGCTTACAGGTGTCAGGATG -3'
Posted On 2019-12-04