Incidental Mutation 'RF010:Rfx4'
Institutional Source Beutler Lab
Gene Symbol Rfx4
Ensembl Gene ENSMUSG00000020037
Gene Nameregulatory factor X, 4 (influences HLA class II expression)
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF010 (G1)
Quality Score217.468
Status Not validated
Chromosomal Location84756062-84906538 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) CTCTCTCT to CTCTCTCTCTCTCTCTATCTCTCT at 84858487 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060397] [ENSMUST00000095388] [ENSMUST00000166696]
Predicted Effect probably benign
Transcript: ENSMUST00000060397
SMART Domains Protein: ENSMUSP00000051107
Gene: ENSMUSG00000020037

Pfam:RFX_DNA_binding 58 136 7.9e-37 PFAM
Blast:HisKA 293 356 5e-7 BLAST
low complexity region 503 515 N/A INTRINSIC
low complexity region 521 537 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095388
SMART Domains Protein: ENSMUSP00000093035
Gene: ENSMUSG00000020037

SCOP:d1kwha_ 11 201 6e-3 SMART
Blast:HisKA 199 262 4e-7 BLAST
low complexity region 409 421 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
low complexity region 505 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166696
SMART Domains Protein: ENSMUSP00000128690
Gene: ENSMUSG00000020037

Blast:HisKA 150 213 6e-7 BLAST
low complexity region 360 372 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
low complexity region 456 468 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X3, and X5. It has been shown to interact with itself as well as with regulatory factors X2 and X3, but it does not interact with regulatory factor X1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Inactivating null allele or homozygous point mutation alleles exhibit missing dorsal midline structure of the cortex including the subcommissural organ and neonatal lethality. Heterozygous null mice have congenital hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Rfx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Rfx4 APN 10 84840199 missense probably damaging 1.00
IGL00334:Rfx4 APN 10 84780053 missense possibly damaging 0.91
IGL00928:Rfx4 APN 10 84840114 missense probably benign 0.04
IGL01063:Rfx4 APN 10 84868382 missense possibly damaging 0.90
IGL01490:Rfx4 APN 10 84840851 missense possibly damaging 0.85
IGL02390:Rfx4 APN 10 84840150 missense probably damaging 1.00
IGL02454:Rfx4 APN 10 84840106 missense possibly damaging 0.83
R0099:Rfx4 UTSW 10 84894304 missense probably benign
R0503:Rfx4 UTSW 10 84894332 missense possibly damaging 0.56
R0924:Rfx4 UTSW 10 84868427 missense probably damaging 1.00
R0930:Rfx4 UTSW 10 84868427 missense probably damaging 1.00
R1386:Rfx4 UTSW 10 84863285 missense probably damaging 1.00
R1715:Rfx4 UTSW 10 84844280 missense probably damaging 1.00
R1738:Rfx4 UTSW 10 84880975 critical splice donor site probably null
R1987:Rfx4 UTSW 10 84896088 missense possibly damaging 0.87
R3717:Rfx4 UTSW 10 84880224 missense probably damaging 1.00
R4231:Rfx4 UTSW 10 84814694 missense probably benign 0.03
R4300:Rfx4 UTSW 10 84905102 missense probably damaging 0.98
R4581:Rfx4 UTSW 10 84844300 missense possibly damaging 0.93
R4582:Rfx4 UTSW 10 84844300 missense possibly damaging 0.93
R4618:Rfx4 UTSW 10 84880896 missense probably benign 0.01
R5156:Rfx4 UTSW 10 84868354 missense probably damaging 1.00
R5185:Rfx4 UTSW 10 84863250 missense probably damaging 1.00
R5377:Rfx4 UTSW 10 84860542 missense possibly damaging 0.81
R5601:Rfx4 UTSW 10 84798578 missense probably damaging 1.00
R5879:Rfx4 UTSW 10 84814761 critical splice donor site probably null
R5996:Rfx4 UTSW 10 84840017 nonsense probably null
R6358:Rfx4 UTSW 10 84844235 missense probably damaging 1.00
R6805:Rfx4 UTSW 10 84840228 missense possibly damaging 0.86
R7248:Rfx4 UTSW 10 84905055 missense probably benign 0.05
R7427:Rfx4 UTSW 10 84896012 missense probably benign 0.28
R7428:Rfx4 UTSW 10 84896012 missense probably benign 0.28
R7514:Rfx4 UTSW 10 84880226 missense probably damaging 1.00
R7576:Rfx4 UTSW 10 84863349 missense probably damaging 0.98
R8002:Rfx4 UTSW 10 84840857 missense probably damaging 0.97
RF014:Rfx4 UTSW 10 84858489 critical splice acceptor site probably benign
RF015:Rfx4 UTSW 10 84858489 critical splice acceptor site probably benign
RF023:Rfx4 UTSW 10 84858485 critical splice acceptor site probably benign
RF030:Rfx4 UTSW 10 84858480 critical splice acceptor site probably benign
RF035:Rfx4 UTSW 10 84858480 critical splice acceptor site probably benign
RF046:Rfx4 UTSW 10 84858481 critical splice acceptor site probably benign
RF060:Rfx4 UTSW 10 84858494 critical splice acceptor site probably benign
RF062:Rfx4 UTSW 10 84858481 critical splice acceptor site probably benign
X0024:Rfx4 UTSW 10 84780074 missense possibly damaging 0.82
Z1177:Rfx4 UTSW 10 84814684 missense possibly damaging 0.85
Z1177:Rfx4 UTSW 10 84896091 missense probably benign 0.30
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04