Incidental Mutation 'RF010:Trim41'
ID603141
Institutional Source Beutler Lab
Gene Symbol Trim41
Ensembl Gene ENSMUSG00000040365
Gene Nametripartite motif-containing 41
SynonymsRINCK
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #RF010 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location48806404-48817353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48807338 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 600 (H600Q)
Ref Sequence ENSEMBL: ENSMUSP00000037055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020640] [ENSMUST00000047145] [ENSMUST00000131888] [ENSMUST00000140800]
Predicted Effect probably benign
Transcript: ENSMUST00000020640
SMART Domains Protein: ENSMUSP00000020640
Gene: ENSMUSG00000020372

DomainStartEndE-ValueType
WD40 4 44 5.55e-7 SMART
WD40 52 91 6.48e-8 SMART
WD40 94 133 2.95e-11 SMART
WD40 135 178 8.55e-8 SMART
WD40 181 220 2.42e-7 SMART
WD40 223 260 6.34e-2 SMART
WD40 271 311 2.4e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000047145
AA Change: H600Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037055
Gene: ENSMUSG00000040365
AA Change: H600Q

DomainStartEndE-ValueType
RING 20 186 2.91e-6 SMART
BBOX 222 263 3.31e-10 SMART
coiled coil region 281 313 N/A INTRINSIC
coiled coil region 336 374 N/A INTRINSIC
PRY 430 482 2.04e-19 SMART
Pfam:SPRY 485 629 6.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131888
SMART Domains Protein: ENSMUSP00000119707
Gene: ENSMUSG00000040365

DomainStartEndE-ValueType
Pfam:DUF3631 9 124 9.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138019
SMART Domains Protein: ENSMUSP00000118789
Gene: ENSMUSG00000040365

DomainStartEndE-ValueType
Blast:RING 2 45 2e-6 BLAST
SCOP:d1jm7b_ 41 75 1e-4 SMART
BBOX 81 122 3.31e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140800
SMART Domains Protein: ENSMUSP00000121705
Gene: ENSMUSG00000040365

DomainStartEndE-ValueType
BBOX 19 60 3.31e-10 SMART
coiled coil region 78 110 N/A INTRINSIC
coiled coil region 133 161 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM family is characterized by a signature motif composed of a RING finger, one or more B-box domains, and a coiled-coil region. This encoded protein may play a role in protein kinase C signaling. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,568,576 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,762,175 probably null Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,627,584 probably benign Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 23,945,351 probably benign Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Trim41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Trim41 APN 11 48812363 missense possibly damaging 0.94
IGL02959:Trim41 APN 11 48807480 missense probably damaging 1.00
R0692:Trim41 UTSW 11 48808250 splice site probably null
R1785:Trim41 UTSW 11 48807592 missense probably damaging 1.00
R1931:Trim41 UTSW 11 48807492 missense probably damaging 0.99
R2130:Trim41 UTSW 11 48807592 missense probably damaging 1.00
R2132:Trim41 UTSW 11 48807592 missense probably damaging 1.00
R2918:Trim41 UTSW 11 48816257 intron probably benign
R3018:Trim41 UTSW 11 48807694 missense probably benign 0.00
R3024:Trim41 UTSW 11 48808158 missense possibly damaging 0.48
R3770:Trim41 UTSW 11 48809084 missense possibly damaging 0.75
R5295:Trim41 UTSW 11 48816257 intron probably benign
R5615:Trim41 UTSW 11 48807365 unclassified probably benign
R5616:Trim41 UTSW 11 48807365 unclassified probably benign
R6673:Trim41 UTSW 11 48816257 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGAAGCAGCCTGGGTTCAAG -3'
(R):5'- TGCCCGTGAATCAACCCATC -3'

Sequencing Primer
(F):5'- TGGGAGGAATCCAGGCTC -3'
(R):5'- TTAGCAGTGGGGATGCCAGC -3'
Posted On2019-12-04