Incidental Mutation 'RF010:Lpo'
ID603145
Institutional Source Beutler Lab
Gene Symbol Lpo
Ensembl Gene ENSMUSG00000009356
Gene Namelactoperoxidase
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF010 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location87806428-87828289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87821102 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 43 (V43A)
Ref Sequence ENSEMBL: ENSMUSP00000099466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103177] [ENSMUST00000136446]
Predicted Effect probably benign
Transcript: ENSMUST00000103177
AA Change: V43A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099466
Gene: ENSMUSG00000009356
AA Change: V43A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:An_peroxidase 136 682 1.8e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136446
AA Change: V43A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117763
Gene: ENSMUSG00000009356
AA Change: V43A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4OEK|A 116 145 4e-7 PDB
SCOP:g1cxp.1 130 145 1e-4 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxidase family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Following its secretion from salivary, mammary, and other mucosal glands, this enzyme catalyzes the generation of the antimicrobial substance hypothiocyanous acid. This gene is present in a gene cluster on chromosome 17. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,568,576 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Chga GCA GCATCA 12: 102,561,403 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,762,175 probably null Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,627,584 probably benign Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 23,945,351 probably benign Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Lpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Lpo APN 11 87821138 missense probably benign 0.43
IGL01833:Lpo APN 11 87807333 missense possibly damaging 0.81
IGL02413:Lpo APN 11 87806906 missense possibly damaging 0.87
IGL02706:Lpo APN 11 87817773 missense probably benign 0.02
IGL02865:Lpo APN 11 87806977 missense possibly damaging 0.80
IGL02939:Lpo APN 11 87815178 missense possibly damaging 0.85
R1072:Lpo UTSW 11 87818434 missense probably damaging 1.00
R1169:Lpo UTSW 11 87817317 missense possibly damaging 0.58
R1667:Lpo UTSW 11 87807241 unclassified probably benign
R1719:Lpo UTSW 11 87809192 splice site probably null
R2133:Lpo UTSW 11 87821130 missense probably benign 0.17
R2871:Lpo UTSW 11 87816524 missense possibly damaging 0.51
R2871:Lpo UTSW 11 87816524 missense possibly damaging 0.51
R4382:Lpo UTSW 11 87822201 missense probably benign 0.14
R4657:Lpo UTSW 11 87814347 missense probably damaging 1.00
R4936:Lpo UTSW 11 87810340 missense probably benign 0.02
R4969:Lpo UTSW 11 87806925 missense probably benign 0.09
R5368:Lpo UTSW 11 87821069 missense possibly damaging 0.61
R5536:Lpo UTSW 11 87816563 missense probably damaging 1.00
R6246:Lpo UTSW 11 87822232 missense unknown
R6556:Lpo UTSW 11 87817763 nonsense probably null
R6817:Lpo UTSW 11 87809241 missense probably benign
R7024:Lpo UTSW 11 87816443 missense probably damaging 1.00
R7203:Lpo UTSW 11 87809251 missense possibly damaging 0.75
R7206:Lpo UTSW 11 87807423 missense probably damaging 1.00
R8355:Lpo UTSW 11 87814288 missense probably damaging 1.00
R8455:Lpo UTSW 11 87814288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCATCTTAGAAGCTGGG -3'
(R):5'- ATCCTAATCTTGAACCCCTATGAG -3'

Sequencing Primer
(F):5'- AGAACTGGGAAGCTAATTGTTTCTGC -3'
(R):5'- TTGAACCCCTATGAGCTAATGGC -3'
Posted On2019-12-04