Incidental Mutation 'RF010:Zfyve26'
ID 603146
Institutional Source Beutler Lab
Gene Symbol Zfyve26
Ensembl Gene ENSMUSG00000066440
Gene Name zinc finger, FYVE domain containing 26
Synonyms A630028O16Rik, 9330197E15Rik, LOC380767
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF010 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 79279120-79343078 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 79302112 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 1828 (C1828Y)
Ref Sequence ENSEMBL: ENSMUSP00000021547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377] [ENSMUST00000219912]
AlphaFold Q5DU37
Predicted Effect probably damaging
Transcript: ENSMUST00000021547
AA Change: C1828Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: C1828Y

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
low complexity region 778 796 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
low complexity region 1073 1091 N/A INTRINSIC
low complexity region 1104 1115 N/A INTRINSIC
low complexity region 1151 1163 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
low complexity region 1228 1241 N/A INTRINSIC
low complexity region 1565 1584 N/A INTRINSIC
low complexity region 1743 1770 N/A INTRINSIC
FYVE 1794 1863 1.49e-27 SMART
low complexity region 2486 2498 N/A INTRINSIC
low complexity region 2517 2528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218377
Predicted Effect probably damaging
Transcript: ENSMUST00000219912
AA Change: C399Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,879,473 (GRCm39) probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Ankrd28 A G 14: 31,500,943 (GRCm39) I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 21,433,927 (GRCm39) probably null Het
Bend3 T A 10: 43,386,180 (GRCm39) F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,129,712 (GRCm39) probably benign Het
Camkv CGCTGCTGC CGC 9: 107,825,059 (GRCm39) probably benign Het
Cfap251 TCTCA T 5: 123,412,224 (GRCm39) probably benign Het
Chga GCA GCATCA 12: 102,527,662 (GRCm39) probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 96,030,278 (GRCm39) probably null Het
Cnot3 T C 7: 3,659,068 (GRCm39) V438A probably benign Het
Cntnap5c T A 17: 58,593,790 (GRCm39) W710R probably damaging Het
Dyrk1a A G 16: 94,478,422 (GRCm39) S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,602,075 (GRCm39) probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,981,149 (GRCm39) probably null Het
Fmn2 T A 1: 174,409,581 (GRCm39) S605T unknown Het
Gab3 TCT TCTGCT X: 74,043,617 (GRCm39) probably benign Het
Gabre GCTC GCTCCGTCTC X: 71,313,666 (GRCm39) probably benign Het
Gli3 A G 13: 15,900,954 (GRCm39) Y1447C probably damaging Het
Hibch T C 1: 52,952,891 (GRCm39) V297A probably benign Het
Ifi213 C G 1: 173,409,719 (GRCm39) D462H probably damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 92,925,597 (GRCm39) probably benign Het
Lpo A G 11: 87,711,928 (GRCm39) V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,136,799 (GRCm39) probably benign Het
Mapk9 A G 11: 49,745,083 (GRCm39) probably benign Het
Mep1a G A 17: 43,797,126 (GRCm39) H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myh3 AC ACTTCC 11: 66,977,185 (GRCm39) probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,458,065 (GRCm39) probably benign Het
Or10ag56 T A 2: 87,139,184 (GRCm39) V37E possibly damaging Het
Or14a259 T C 7: 86,012,594 (GRCm39) Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,101,890 (GRCm39) probably null Het
Pfkm T A 15: 98,027,674 (GRCm39) I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,325,920 (GRCm39) probably null Het
Polr1has CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 37,275,955 (GRCm39) probably benign Het
Prkce T C 17: 86,795,627 (GRCm39) V288A probably damaging Het
Pxmp4 A G 2: 154,434,183 (GRCm39) S93P probably damaging Het
Rfc4 T C 16: 22,946,232 (GRCm39) T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,694,351 (GRCm39) probably benign Het
Ryr3 G T 2: 112,606,015 (GRCm39) A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 24,164,325 (GRCm39) probably benign Het
Sec24c T A 14: 20,738,783 (GRCm39) probably null Het
Sec63 C A 10: 42,682,620 (GRCm39) A437E probably benign Het
Six3 GCG GCGTCG 17: 85,928,783 (GRCm39) probably benign Het
Slco5a1 G A 1: 12,942,171 (GRCm39) T825I probably damaging Het
Spmap2l CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,164,274 (GRCm39) probably benign Het
Stard8 GGA GGAAGA X: 98,110,123 (GRCm39) probably benign Het
Stxbp1 A G 2: 32,711,927 (GRCm39) V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,635,083 (GRCm39) probably benign Het
Syne1 T A 10: 5,196,386 (GRCm39) D3882V possibly damaging Het
T A G 17: 8,660,540 (GRCm39) T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,825,384 (GRCm39) probably benign Het
Tcof1 CAG CAGAAG 18: 60,968,816 (GRCm39) probably benign Het
Tcstv5 A T 13: 120,411,582 (GRCm39) V8E probably benign Het
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Tfeb CAG CAGAAG 17: 48,097,032 (GRCm39) probably benign Het
Thumpd3 C T 6: 113,033,006 (GRCm39) A248V probably damaging Het
Tlcd4 T A 3: 121,022,533 (GRCm39) I103L probably benign Het
Tmem181a T C 17: 6,330,978 (GRCm39) probably null Het
Trim41 A T 11: 48,698,165 (GRCm39) H600Q probably damaging Het
Ttbk2 A T 2: 120,620,820 (GRCm39) C147* probably null Het
Ttll2 C T 17: 7,618,737 (GRCm39) A397T probably benign Het
Unc79 T A 12: 103,079,046 (GRCm39) L1737Q probably benign Het
Usp47 T A 7: 111,692,145 (GRCm39) V869E probably damaging Het
Vmn1r231 T A 17: 21,110,255 (GRCm39) Q220L probably damaging Het
Vmn2r26 C T 6: 124,016,448 (GRCm39) T304I possibly damaging Het
Wrn T C 8: 33,778,793 (GRCm39) N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,013,451 (GRCm39) probably benign Het
Other mutations in Zfyve26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Zfyve26 APN 12 79,296,234 (GRCm39) unclassified probably benign
IGL00940:Zfyve26 APN 12 79,327,674 (GRCm39) missense probably benign
IGL01148:Zfyve26 APN 12 79,307,644 (GRCm39) missense probably benign 0.01
IGL01347:Zfyve26 APN 12 79,298,957 (GRCm39) splice site probably null
IGL01472:Zfyve26 APN 12 79,323,117 (GRCm39) missense probably benign 0.01
IGL01490:Zfyve26 APN 12 79,291,147 (GRCm39) missense probably damaging 1.00
IGL01516:Zfyve26 APN 12 79,334,625 (GRCm39) missense probably benign 0.37
IGL01642:Zfyve26 APN 12 79,308,348 (GRCm39) splice site probably null
IGL01689:Zfyve26 APN 12 79,330,827 (GRCm39) missense possibly damaging 0.71
IGL01877:Zfyve26 APN 12 79,334,218 (GRCm39) missense probably damaging 1.00
IGL01997:Zfyve26 APN 12 79,291,174 (GRCm39) missense probably benign 0.00
IGL02077:Zfyve26 APN 12 79,323,169 (GRCm39) missense possibly damaging 0.54
IGL02437:Zfyve26 APN 12 79,315,621 (GRCm39) missense probably benign 0.01
IGL02933:Zfyve26 APN 12 79,326,854 (GRCm39) missense possibly damaging 0.94
IGL02937:Zfyve26 APN 12 79,285,794 (GRCm39) missense probably benign 0.08
IGL02982:Zfyve26 APN 12 79,310,644 (GRCm39) missense probably damaging 0.99
IGL03064:Zfyve26 APN 12 79,308,565 (GRCm39) missense probably damaging 1.00
IGL03086:Zfyve26 APN 12 79,342,338 (GRCm39) missense probably damaging 0.96
IGL03146:Zfyve26 APN 12 79,330,846 (GRCm39) nonsense probably null
challenge UTSW 12 79,317,610 (GRCm39) critical splice donor site probably null
fourteener UTSW 12 79,302,037 (GRCm39) missense probably damaging 1.00
IGL02799:Zfyve26 UTSW 12 79,320,084 (GRCm39) missense probably benign 0.28
R0318:Zfyve26 UTSW 12 79,323,055 (GRCm39) missense probably damaging 1.00
R0513:Zfyve26 UTSW 12 79,291,258 (GRCm39) missense probably damaging 1.00
R0582:Zfyve26 UTSW 12 79,292,996 (GRCm39) missense probably damaging 1.00
R0586:Zfyve26 UTSW 12 79,315,502 (GRCm39) missense possibly damaging 0.96
R0718:Zfyve26 UTSW 12 79,312,576 (GRCm39) splice site probably benign
R0738:Zfyve26 UTSW 12 79,342,308 (GRCm39) missense probably damaging 1.00
R0781:Zfyve26 UTSW 12 79,326,841 (GRCm39) missense probably damaging 0.99
R0894:Zfyve26 UTSW 12 79,320,372 (GRCm39) missense possibly damaging 0.80
R1109:Zfyve26 UTSW 12 79,318,901 (GRCm39) missense probably damaging 1.00
R1110:Zfyve26 UTSW 12 79,326,841 (GRCm39) missense probably damaging 0.99
R1186:Zfyve26 UTSW 12 79,310,723 (GRCm39) missense probably damaging 1.00
R1295:Zfyve26 UTSW 12 79,321,694 (GRCm39) missense probably damaging 1.00
R1430:Zfyve26 UTSW 12 79,329,591 (GRCm39) missense probably benign 0.07
R1439:Zfyve26 UTSW 12 79,298,937 (GRCm39) missense probably benign 0.03
R1517:Zfyve26 UTSW 12 79,298,925 (GRCm39) missense probably damaging 0.98
R1553:Zfyve26 UTSW 12 79,334,535 (GRCm39) missense probably benign 0.00
R1721:Zfyve26 UTSW 12 79,308,573 (GRCm39) missense possibly damaging 0.94
R1758:Zfyve26 UTSW 12 79,285,718 (GRCm39) missense probably damaging 1.00
R1779:Zfyve26 UTSW 12 79,325,237 (GRCm39) missense probably damaging 1.00
R1785:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R1786:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R1826:Zfyve26 UTSW 12 79,315,823 (GRCm39) missense probably damaging 1.00
R1833:Zfyve26 UTSW 12 79,333,032 (GRCm39) missense probably benign 0.36
R1868:Zfyve26 UTSW 12 79,308,573 (GRCm39) missense possibly damaging 0.94
R1900:Zfyve26 UTSW 12 79,311,125 (GRCm39) missense probably damaging 1.00
R1928:Zfyve26 UTSW 12 79,286,744 (GRCm39) nonsense probably null
R1982:Zfyve26 UTSW 12 79,302,017 (GRCm39) missense possibly damaging 0.55
R2062:Zfyve26 UTSW 12 79,330,806 (GRCm39) splice site probably null
R2071:Zfyve26 UTSW 12 79,334,220 (GRCm39) missense possibly damaging 0.95
R2130:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2132:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2133:Zfyve26 UTSW 12 79,315,208 (GRCm39) missense possibly damaging 0.48
R2135:Zfyve26 UTSW 12 79,292,826 (GRCm39) missense possibly damaging 0.80
R2207:Zfyve26 UTSW 12 79,292,861 (GRCm39) missense probably damaging 0.99
R2280:Zfyve26 UTSW 12 79,321,814 (GRCm39) missense probably damaging 1.00
R2352:Zfyve26 UTSW 12 79,330,890 (GRCm39) missense probably damaging 1.00
R2398:Zfyve26 UTSW 12 79,329,573 (GRCm39) splice site probably null
R3084:Zfyve26 UTSW 12 79,312,457 (GRCm39) splice site probably benign
R3086:Zfyve26 UTSW 12 79,312,457 (GRCm39) splice site probably benign
R4626:Zfyve26 UTSW 12 79,315,844 (GRCm39) missense possibly damaging 0.95
R4727:Zfyve26 UTSW 12 79,291,170 (GRCm39) missense probably benign 0.16
R4908:Zfyve26 UTSW 12 79,296,469 (GRCm39) splice site probably null
R4926:Zfyve26 UTSW 12 79,321,785 (GRCm39) missense probably benign
R4990:Zfyve26 UTSW 12 79,334,607 (GRCm39) missense probably damaging 1.00
R4999:Zfyve26 UTSW 12 79,327,159 (GRCm39) nonsense probably null
R5029:Zfyve26 UTSW 12 79,333,097 (GRCm39) missense probably damaging 0.99
R5070:Zfyve26 UTSW 12 79,302,135 (GRCm39) missense probably damaging 1.00
R5100:Zfyve26 UTSW 12 79,326,832 (GRCm39) nonsense probably null
R5252:Zfyve26 UTSW 12 79,315,756 (GRCm39) missense probably damaging 1.00
R5318:Zfyve26 UTSW 12 79,317,624 (GRCm39) missense probably benign 0.35
R5509:Zfyve26 UTSW 12 79,293,295 (GRCm39) missense probably damaging 1.00
R5574:Zfyve26 UTSW 12 79,286,698 (GRCm39) missense possibly damaging 0.63
R5735:Zfyve26 UTSW 12 79,320,147 (GRCm39) missense probably damaging 0.96
R5756:Zfyve26 UTSW 12 79,311,131 (GRCm39) missense probably damaging 1.00
R5773:Zfyve26 UTSW 12 79,334,511 (GRCm39) missense probably damaging 1.00
R5834:Zfyve26 UTSW 12 79,313,311 (GRCm39) missense probably benign 0.30
R6075:Zfyve26 UTSW 12 79,340,628 (GRCm39) missense possibly damaging 0.74
R6184:Zfyve26 UTSW 12 79,315,501 (GRCm39) missense probably damaging 0.98
R6235:Zfyve26 UTSW 12 79,296,373 (GRCm39) missense probably damaging 1.00
R6247:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.04
R6320:Zfyve26 UTSW 12 79,286,776 (GRCm39) missense probably damaging 0.97
R6548:Zfyve26 UTSW 12 79,285,109 (GRCm39) missense probably damaging 1.00
R6887:Zfyve26 UTSW 12 79,313,223 (GRCm39) missense probably damaging 1.00
R7133:Zfyve26 UTSW 12 79,330,926 (GRCm39) missense probably benign 0.06
R7152:Zfyve26 UTSW 12 79,325,888 (GRCm39) missense probably benign 0.42
R7165:Zfyve26 UTSW 12 79,327,179 (GRCm39) missense probably damaging 1.00
R7181:Zfyve26 UTSW 12 79,315,182 (GRCm39) missense probably benign 0.00
R7223:Zfyve26 UTSW 12 79,292,945 (GRCm39) missense probably damaging 0.99
R7296:Zfyve26 UTSW 12 79,325,146 (GRCm39) splice site probably null
R7299:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.01
R7301:Zfyve26 UTSW 12 79,329,758 (GRCm39) missense probably benign 0.01
R7302:Zfyve26 UTSW 12 79,297,942 (GRCm39) missense probably damaging 1.00
R7355:Zfyve26 UTSW 12 79,286,828 (GRCm39) missense probably damaging 1.00
R7466:Zfyve26 UTSW 12 79,334,581 (GRCm39) missense probably benign 0.00
R7540:Zfyve26 UTSW 12 79,315,450 (GRCm39) missense probably damaging 0.99
R7552:Zfyve26 UTSW 12 79,337,731 (GRCm39) missense probably damaging 0.97
R7762:Zfyve26 UTSW 12 79,315,409 (GRCm39) missense probably benign 0.02
R7806:Zfyve26 UTSW 12 79,327,129 (GRCm39) critical splice donor site probably null
R7821:Zfyve26 UTSW 12 79,302,098 (GRCm39) missense probably damaging 1.00
R8141:Zfyve26 UTSW 12 79,315,331 (GRCm39) missense possibly damaging 0.79
R8190:Zfyve26 UTSW 12 79,327,610 (GRCm39) missense probably benign 0.00
R8207:Zfyve26 UTSW 12 79,307,605 (GRCm39) missense probably damaging 1.00
R8210:Zfyve26 UTSW 12 79,302,037 (GRCm39) missense probably damaging 1.00
R8500:Zfyve26 UTSW 12 79,334,454 (GRCm39) missense probably damaging 0.99
R8686:Zfyve26 UTSW 12 79,334,227 (GRCm39) missense probably benign
R8758:Zfyve26 UTSW 12 79,311,083 (GRCm39) critical splice donor site probably benign
R8826:Zfyve26 UTSW 12 79,285,742 (GRCm39) missense probably benign 0.05
R8877:Zfyve26 UTSW 12 79,334,152 (GRCm39) missense probably benign 0.05
R9067:Zfyve26 UTSW 12 79,318,915 (GRCm39) missense probably damaging 0.99
R9195:Zfyve26 UTSW 12 79,311,168 (GRCm39) missense probably benign 0.12
R9269:Zfyve26 UTSW 12 79,323,076 (GRCm39) missense possibly damaging 0.73
R9273:Zfyve26 UTSW 12 79,317,610 (GRCm39) critical splice donor site probably null
R9340:Zfyve26 UTSW 12 79,321,680 (GRCm39) nonsense probably null
R9348:Zfyve26 UTSW 12 79,315,231 (GRCm39) missense possibly damaging 0.81
R9482:Zfyve26 UTSW 12 79,291,239 (GRCm39) missense probably damaging 1.00
R9536:Zfyve26 UTSW 12 79,298,046 (GRCm39) missense probably benign 0.32
R9653:Zfyve26 UTSW 12 79,334,418 (GRCm39) missense probably benign
R9676:Zfyve26 UTSW 12 79,330,959 (GRCm39) missense probably benign 0.01
R9797:Zfyve26 UTSW 12 79,293,006 (GRCm39) missense probably damaging 0.98
X0020:Zfyve26 UTSW 12 79,285,779 (GRCm39) missense probably damaging 1.00
Z1176:Zfyve26 UTSW 12 79,315,307 (GRCm39) missense probably benign 0.07
Z1177:Zfyve26 UTSW 12 79,334,149 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTCTGTGGTGTAATACAGTG -3'
(R):5'- AACCCAAGTGCCCAGTATTC -3'

Sequencing Primer
(F):5'- CTCTGTGGTGTAATACAGTGTAATAC -3'
(R):5'- CCAAGTGCCCAGTATTCTTAATTGAC -3'
Posted On 2019-12-04