Incidental Mutation 'RF010:Chga'
ID603147
Institutional Source Beutler Lab
Gene Symbol Chga
Ensembl Gene ENSMUSG00000021194
Gene Namechromogranin A
SynonymsChrA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #RF010 (G1)
Quality Score162.468
Status Not validated
Chromosome12
Chromosomal Location102554969-102565028 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GCA to GCATCA at 102561403 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021610]
Predicted Effect probably benign
Transcript: ENSMUST00000021610
SMART Domains Protein: ENSMUSP00000021610
Gene: ENSMUSG00000021194

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Granin 25 95 3e-26 PFAM
Pfam:Granin 87 463 1.7e-95 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the granin family of acidic secretory glycoproteins that are expressed in endocrine cells and neurons. The encoded preproprotein undergoes proteolytic processing to generate multiple functions peptides including pancreastatin, catestatin and serpinin. The encoded protein plays important roles in the neuroendocrine system including regulated secretion of peptide hormones and neurotransmitters. Mice lacking the encoded protein exhibit elevated blood pressure which can be rescued by transgenic expression of the human ortholog. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes and heterozygotes for one allele display hypertension, abnormal plasma and adrenal adrenaline and noradrenaline levels and, in homozygotes, partial embryonic lethality. Homozygotes for a second allele only have elevated urinary adrenaline, noradrenaline and dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,568,576 probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Ankrd28 A G 14: 31,778,986 I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 20,943,911 probably null Het
B020031M17Rik A T 13: 119,950,046 V8E probably benign Het
Bend3 T A 10: 43,510,184 F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,141,273 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 95,303,650 probably null Het
Cnot3 T C 7: 3,656,069 V438A probably benign Het
Cntnap5c T A 17: 58,286,795 W710R probably damaging Het
Dyrk1a A G 16: 94,677,563 S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,764 probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,762,175 probably null Het
Fmn2 T A 1: 174,582,015 S605T unknown Het
Gab3 TCT TCTGCT X: 75,000,011 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,060 probably benign Het
Gli3 A G 13: 15,726,369 Y1447C probably damaging Het
Hibch T C 1: 52,913,732 V297A probably benign Het
Ifi213 C G 1: 173,582,153 D462H probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 93,018,290 probably benign Het
Lpo A G 11: 87,821,102 V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,306,318 probably benign Het
Mapk9 A G 11: 49,854,256 probably benign Het
Mep1a G A 17: 43,486,235 H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 67,086,356 probably null Het
Myh3 AC ACTTCC 11: 67,086,359 probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,627,584 probably benign Het
Olfr1118 T A 2: 87,308,840 V37E possibly damaging Het
Olfr305 T C 7: 86,363,386 Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,113,451 probably null Het
Pfkm T A 15: 98,129,793 I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,626,495 probably null Het
Prkce T C 17: 86,488,199 V288A probably damaging Het
Pxmp4 A G 2: 154,592,263 S93P probably damaging Het
Rfc4 T C 16: 23,127,482 T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,858,487 probably benign Het
Ryr3 G T 2: 112,775,670 A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 23,945,351 probably benign Het
Sec24c T A 14: 20,688,715 probably null Het
Sec63 C A 10: 42,806,624 A437E probably benign Het
Six3 GCG GCGTCG 17: 85,621,355 probably benign Het
Slco5a1 G A 1: 12,871,947 T825I probably damaging Het
Stard8 GGA GGAAGA X: 99,066,517 probably benign Het
Stxbp1 A G 2: 32,821,915 V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,727,662 probably benign Het
Syne1 T A 10: 5,246,386 D3882V possibly damaging Het
T A G 17: 8,441,708 T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,836,940 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,744 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,107 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,016,427 probably benign Het
Thumpd3 C T 6: 113,056,045 A248V probably damaging Het
Tmem181a T C 17: 6,280,703 probably null Het
Tmem56 T A 3: 121,228,884 I103L probably benign Het
Trim41 A T 11: 48,807,338 H600Q probably damaging Het
Ttbk2 A T 2: 120,790,339 C147* probably null Het
Ttll2 C T 17: 7,351,338 A397T probably benign Het
Unc79 T A 12: 103,112,787 L1737Q probably benign Het
Usp47 T A 7: 112,092,938 V869E probably damaging Het
Vmn1r231 T A 17: 20,889,993 Q220L probably damaging Het
Vmn2r26 C T 6: 124,039,489 T304I possibly damaging Het
Wdr66 TCTCA T 5: 123,274,161 probably benign Het
Wrn T C 8: 33,288,765 N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,036,488 probably benign Het
Zfyve26 C T 12: 79,255,338 C1828Y probably damaging Het
Znrd1as CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 36,965,063 probably benign Het
Other mutations in Chga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chga APN 12 102562799 missense probably damaging 0.98
IGL02674:Chga APN 12 102562901 missense probably damaging 1.00
FR4589:Chga UTSW 12 102561402 small insertion probably benign
R0018:Chga UTSW 12 102558505 missense probably damaging 0.97
R0463:Chga UTSW 12 102562951 nonsense probably null
R1164:Chga UTSW 12 102563045 missense probably damaging 1.00
R1603:Chga UTSW 12 102564607 splice site probably null
R1727:Chga UTSW 12 102561437 missense possibly damaging 0.85
R1778:Chga UTSW 12 102561700 missense probably benign
R1800:Chga UTSW 12 102555905 missense probably damaging 0.99
R2071:Chga UTSW 12 102562863 missense probably damaging 1.00
R3415:Chga UTSW 12 102562784 missense probably benign 0.00
R3696:Chga UTSW 12 102561465 missense probably damaging 0.98
R5022:Chga UTSW 12 102562837 missense probably damaging 1.00
R5507:Chga UTSW 12 102562609 missense probably benign 0.39
R5959:Chga UTSW 12 102561855 missense probably benign
R7338:Chga UTSW 12 102562841 missense probably damaging 1.00
R7410:Chga UTSW 12 102562607 missense probably benign 0.00
R7694:Chga UTSW 12 102561347 missense probably benign 0.05
R8084:Chga UTSW 12 102562069 missense probably benign 0.29
R8211:Chga UTSW 12 102561419 missense possibly damaging 0.71
RF001:Chga UTSW 12 102561423 small insertion probably benign
RF002:Chga UTSW 12 102561421 small insertion probably benign
RF006:Chga UTSW 12 102561412 small insertion probably benign
RF009:Chga UTSW 12 102561420 small insertion probably benign
RF014:Chga UTSW 12 102561393 small insertion probably benign
RF014:Chga UTSW 12 102561405 small insertion probably benign
RF015:Chga UTSW 12 102561420 small insertion probably benign
RF022:Chga UTSW 12 102561420 small insertion probably benign
RF033:Chga UTSW 12 102561396 small insertion probably benign
RF035:Chga UTSW 12 102561427 small insertion probably benign
RF044:Chga UTSW 12 102561396 small insertion probably benign
RF048:Chga UTSW 12 102561403 small insertion probably benign
RF048:Chga UTSW 12 102561421 small insertion probably benign
RF049:Chga UTSW 12 102561393 small insertion probably benign
RF052:Chga UTSW 12 102561416 small insertion probably benign
RF054:Chga UTSW 12 102561423 small insertion probably benign
RF056:Chga UTSW 12 102561424 small insertion probably benign
RF058:Chga UTSW 12 102561416 small insertion probably benign
RF060:Chga UTSW 12 102561424 small insertion probably benign
RF061:Chga UTSW 12 102561413 small insertion probably benign
RF061:Chga UTSW 12 102561427 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGCTCTCTAAGGTACAAGTAGAAC -3'
(R):5'- AAGAAGCAGCATCACCTGGG -3'

Sequencing Primer
(F):5'- AAGTAGAACTTTCTCACATTTCCCAC -3'
(R):5'- GCATCACCTGGGGACTACTGTTC -3'
Posted On2019-12-04