Incidental Mutation 'RF010:Unc79'
ID 603148
Institutional Source Beutler Lab
Gene Symbol Unc79
Ensembl Gene ENSMUSG00000021198
Gene Name unc-79 homolog
Synonyms 9030205A07Rik, Mlca3
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF010 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 102915118-103150324 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103079046 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1737 (L1737Q)
Ref Sequence ENSEMBL: ENSMUSP00000136332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085079] [ENSMUST00000101099] [ENSMUST00000178076] [ENSMUST00000179002]
AlphaFold Q0KK59
Predicted Effect possibly damaging
Transcript: ENSMUST00000085079
AA Change: L1541Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082156
Gene: ENSMUSG00000021198
AA Change: L1541Q

DomainStartEndE-ValueType
Pfam:UNC-79 1 469 3.1e-223 PFAM
low complexity region 732 737 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1428 1440 N/A INTRINSIC
low complexity region 1471 1476 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1490 1504 N/A INTRINSIC
low complexity region 1541 1556 N/A INTRINSIC
low complexity region 1861 1870 N/A INTRINSIC
low complexity region 2237 2246 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101099
AA Change: L1718Q

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098659
Gene: ENSMUSG00000021198
AA Change: L1718Q

DomainStartEndE-ValueType
Pfam:UNC-79 113 646 1.2e-226 PFAM
low complexity region 909 914 N/A INTRINSIC
low complexity region 1023 1039 N/A INTRINSIC
low complexity region 1145 1154 N/A INTRINSIC
low complexity region 1291 1302 N/A INTRINSIC
low complexity region 1490 1502 N/A INTRINSIC
low complexity region 1605 1617 N/A INTRINSIC
low complexity region 1648 1653 N/A INTRINSIC
low complexity region 1654 1666 N/A INTRINSIC
low complexity region 1667 1681 N/A INTRINSIC
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1999 2008 N/A INTRINSIC
low complexity region 2375 2384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177984
Predicted Effect probably benign
Transcript: ENSMUST00000178076
AA Change: L1544Q

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136888
Gene: ENSMUSG00000021198
AA Change: L1544Q

DomainStartEndE-ValueType
Pfam:UNC-79 1 450 4.2e-213 PFAM
low complexity region 713 718 N/A INTRINSIC
low complexity region 827 843 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 1117 1128 N/A INTRINSIC
low complexity region 1316 1328 N/A INTRINSIC
low complexity region 1431 1443 N/A INTRINSIC
low complexity region 1474 1479 N/A INTRINSIC
low complexity region 1480 1492 N/A INTRINSIC
low complexity region 1493 1507 N/A INTRINSIC
low complexity region 1544 1559 N/A INTRINSIC
low complexity region 1864 1873 N/A INTRINSIC
low complexity region 2240 2249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179002
AA Change: L1737Q

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136332
Gene: ENSMUSG00000021198
AA Change: L1737Q

DomainStartEndE-ValueType
Pfam:UNC-79 60 593 1.3e-226 PFAM
low complexity region 856 861 N/A INTRINSIC
low complexity region 970 986 N/A INTRINSIC
low complexity region 1092 1101 N/A INTRINSIC
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1509 1521 N/A INTRINSIC
low complexity region 1624 1636 N/A INTRINSIC
low complexity region 1667 1672 N/A INTRINSIC
low complexity region 1673 1685 N/A INTRINSIC
low complexity region 1686 1700 N/A INTRINSIC
low complexity region 1737 1752 N/A INTRINSIC
low complexity region 2057 2066 N/A INTRINSIC
low complexity region 2433 2442 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NALCN channel is responsible for Na(+) leak currents. The protein encoded by this gene, along with UNC80, is an accessory subunit of the NALCN channel that contributes to the Ca(2+) sensitivity of the channel. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation results in lethality within the first week after birth, mostly at P0 or P1. Pups fail to nurse and have no milk in stomachs resulting in weakness, inactivity and no weight gain. [provided by MGI curators]
Allele List at MGI

 All alleles(2) : Targeted, knock-out(1) Chemically induced(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG 17: 35,879,473 (GRCm39) probably benign Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Ankrd28 A G 14: 31,500,943 (GRCm39) I16T probably damaging Het
AY761185 GCACTGTGGGC G 8: 21,433,927 (GRCm39) probably null Het
Bend3 T A 10: 43,386,180 (GRCm39) F191Y possibly damaging Het
Calhm1 GTGGC GTGGCTGTGGCTATGGC 19: 47,129,712 (GRCm39) probably benign Het
Camkv CGCTGCTGC CGC 9: 107,825,059 (GRCm39) probably benign Het
Cfap251 TCTCA T 5: 123,412,224 (GRCm39) probably benign Het
Chga GCA GCATCA 12: 102,527,662 (GRCm39) probably benign Het
Cngb1 CTCTGGCTCTGGCTCTGGCTCTG C 8: 96,030,278 (GRCm39) probably null Het
Cnot3 T C 7: 3,659,068 (GRCm39) V438A probably benign Het
Cntnap5c T A 17: 58,593,790 (GRCm39) W710R probably damaging Het
Dyrk1a A G 16: 94,478,422 (GRCm39) S404G probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,602,075 (GRCm39) probably benign Het
Flywch1 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT 17: 23,981,149 (GRCm39) probably null Het
Fmn2 T A 1: 174,409,581 (GRCm39) S605T unknown Het
Gab3 TCT TCTGCT X: 74,043,617 (GRCm39) probably benign Het
Gabre GCTC GCTCCGTCTC X: 71,313,666 (GRCm39) probably benign Het
Gli3 A G 13: 15,900,954 (GRCm39) Y1447C probably damaging Het
Hibch T C 1: 52,952,891 (GRCm39) V297A probably benign Het
Ifi213 C G 1: 173,409,719 (GRCm39) D462H probably damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Lce1m GCTGCTGCC GCTGCTGCCCCCACTGCTGCC 3: 92,925,597 (GRCm39) probably benign Het
Lpo A G 11: 87,711,928 (GRCm39) V43A probably benign Het
Map1a A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC 2: 121,136,799 (GRCm39) probably benign Het
Mapk9 A G 11: 49,745,083 (GRCm39) probably benign Het
Mep1a G A 17: 43,797,126 (GRCm39) H314Y probably damaging Het
Myh3 ATTAC ATTACTTAC 11: 66,977,182 (GRCm39) probably null Het
Myh3 AC ACTTCC 11: 66,977,185 (GRCm39) probably null Het
Nusap1 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA 2: 119,458,065 (GRCm39) probably benign Het
Or10ag56 T A 2: 87,139,184 (GRCm39) V37E possibly damaging Het
Or14a259 T C 7: 86,012,594 (GRCm39) Q317R probably benign Het
Pdcd11 AGGAGG A 19: 47,101,890 (GRCm39) probably null Het
Pfkm T A 15: 98,027,674 (GRCm39) I651N possibly damaging Het
Phldb3 CCCCCGCCCC CCCCC 7: 24,325,920 (GRCm39) probably null Het
Polr1has CACCACCAC CACCACCACCACCACCACCACTACCACCAC 17: 37,275,955 (GRCm39) probably benign Het
Prkce T C 17: 86,795,627 (GRCm39) V288A probably damaging Het
Pxmp4 A G 2: 154,434,183 (GRCm39) S93P probably damaging Het
Rfc4 T C 16: 22,946,232 (GRCm39) T17A probably benign Het
Rfx4 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT 10: 84,694,351 (GRCm39) probably benign Het
Ryr3 G T 2: 112,606,015 (GRCm39) A2415E probably damaging Het
Sbp ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA 17: 24,164,325 (GRCm39) probably benign Het
Sec24c T A 14: 20,738,783 (GRCm39) probably null Het
Sec63 C A 10: 42,682,620 (GRCm39) A437E probably benign Het
Six3 GCG GCGTCG 17: 85,928,783 (GRCm39) probably benign Het
Slco5a1 G A 1: 12,942,171 (GRCm39) T825I probably damaging Het
Spmap2l CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG 5: 77,164,274 (GRCm39) probably benign Het
Stard8 GGA GGAAGA X: 98,110,123 (GRCm39) probably benign Het
Stxbp1 A G 2: 32,711,927 (GRCm39) V30A probably benign Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,635,083 (GRCm39) probably benign Het
Syne1 T A 10: 5,196,386 (GRCm39) D3882V possibly damaging Het
T A G 17: 8,660,540 (GRCm39) T384A probably benign Het
Tbc1d12 CGGGGCGG CG 19: 38,825,384 (GRCm39) probably benign Het
Tcof1 CAG CAGAAG 18: 60,968,816 (GRCm39) probably benign Het
Tcstv5 A T 13: 120,411,582 (GRCm39) V8E probably benign Het
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Tfeb CAG CAGAAG 17: 48,097,032 (GRCm39) probably benign Het
Thumpd3 C T 6: 113,033,006 (GRCm39) A248V probably damaging Het
Tlcd4 T A 3: 121,022,533 (GRCm39) I103L probably benign Het
Tmem181a T C 17: 6,330,978 (GRCm39) probably null Het
Trim41 A T 11: 48,698,165 (GRCm39) H600Q probably damaging Het
Ttbk2 A T 2: 120,620,820 (GRCm39) C147* probably null Het
Ttll2 C T 17: 7,618,737 (GRCm39) A397T probably benign Het
Usp47 T A 7: 111,692,145 (GRCm39) V869E probably damaging Het
Vmn1r231 T A 17: 21,110,255 (GRCm39) Q220L probably damaging Het
Vmn2r26 C T 6: 124,016,448 (GRCm39) T304I possibly damaging Het
Wrn T C 8: 33,778,793 (GRCm39) N839S probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp384 GGCCCAGG GGCCCAGGAGCACGCCCAGG 6: 125,013,451 (GRCm39) probably benign Het
Zfyve26 C T 12: 79,302,112 (GRCm39) C1828Y probably damaging Het
Other mutations in Unc79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Unc79 APN 12 103,135,906 (GRCm39) missense possibly damaging 0.68
IGL00835:Unc79 APN 12 103,108,149 (GRCm39) splice site probably benign
IGL00917:Unc79 APN 12 103,054,766 (GRCm39) missense possibly damaging 0.53
IGL01012:Unc79 APN 12 103,078,714 (GRCm39) missense probably damaging 1.00
IGL01121:Unc79 APN 12 103,131,890 (GRCm39) missense probably damaging 0.99
IGL01303:Unc79 APN 12 103,128,126 (GRCm39) missense possibly damaging 0.94
IGL01305:Unc79 APN 12 102,968,130 (GRCm39) missense probably damaging 0.99
IGL01315:Unc79 APN 12 103,054,780 (GRCm39) missense possibly damaging 0.66
IGL01388:Unc79 APN 12 103,136,018 (GRCm39) splice site probably benign
IGL01415:Unc79 APN 12 103,074,944 (GRCm39) missense probably damaging 1.00
IGL01447:Unc79 APN 12 103,045,177 (GRCm39) missense probably damaging 1.00
IGL01655:Unc79 APN 12 103,134,546 (GRCm39) missense probably benign 0.00
IGL01662:Unc79 APN 12 103,115,279 (GRCm39) missense possibly damaging 0.92
IGL01728:Unc79 APN 12 103,131,943 (GRCm39) missense probably damaging 0.98
IGL01767:Unc79 APN 12 103,108,256 (GRCm39) missense probably damaging 1.00
IGL02080:Unc79 APN 12 102,968,234 (GRCm39) missense probably damaging 1.00
IGL02115:Unc79 APN 12 102,964,933 (GRCm39) missense probably damaging 1.00
IGL02176:Unc79 APN 12 102,965,006 (GRCm39) splice site probably null
IGL02186:Unc79 APN 12 102,977,542 (GRCm39) missense probably benign 0.04
IGL02205:Unc79 APN 12 103,045,260 (GRCm39) missense probably damaging 1.00
IGL02337:Unc79 APN 12 103,122,705 (GRCm39) splice site probably benign
IGL02498:Unc79 APN 12 103,137,837 (GRCm39) missense probably damaging 0.99
IGL02508:Unc79 APN 12 103,078,535 (GRCm39) missense probably damaging 0.97
IGL02508:Unc79 APN 12 103,078,277 (GRCm39) splice site probably benign
IGL02557:Unc79 APN 12 103,148,418 (GRCm39) splice site probably benign
IGL02589:Unc79 APN 12 103,139,755 (GRCm39) missense probably damaging 1.00
IGL02611:Unc79 APN 12 103,131,967 (GRCm39) missense probably damaging 0.97
IGL02728:Unc79 APN 12 103,088,688 (GRCm39) missense possibly damaging 0.53
IGL02827:Unc79 APN 12 103,041,105 (GRCm39) missense possibly damaging 0.88
IGL03028:Unc79 APN 12 103,139,785 (GRCm39) missense possibly damaging 0.83
IGL03144:Unc79 APN 12 103,008,401 (GRCm39) missense probably damaging 1.00
IGL03229:Unc79 APN 12 103,100,798 (GRCm39) missense probably damaging 0.99
IGL03269:Unc79 APN 12 103,054,936 (GRCm39) missense probably damaging 1.00
IGL03325:Unc79 APN 12 103,135,869 (GRCm39) missense probably damaging 0.98
pencil-thin UTSW 12 103,075,040 (GRCm39) splice site probably null
sweetpea UTSW 12 103,025,777 (GRCm39) missense probably damaging 1.00
3-1:Unc79 UTSW 12 103,039,009 (GRCm39) nonsense probably null
ANU22:Unc79 UTSW 12 102,968,130 (GRCm39) missense probably damaging 0.99
R0046:Unc79 UTSW 12 103,091,940 (GRCm39) missense probably damaging 0.99
R0046:Unc79 UTSW 12 103,091,940 (GRCm39) missense probably damaging 0.99
R0067:Unc79 UTSW 12 103,025,777 (GRCm39) missense probably damaging 1.00
R0067:Unc79 UTSW 12 103,025,777 (GRCm39) missense probably damaging 1.00
R0107:Unc79 UTSW 12 103,100,784 (GRCm39) missense possibly damaging 0.70
R0110:Unc79 UTSW 12 103,045,329 (GRCm39) critical splice donor site probably null
R0128:Unc79 UTSW 12 103,054,693 (GRCm39) splice site probably benign
R0166:Unc79 UTSW 12 103,122,812 (GRCm39) missense probably damaging 1.00
R0208:Unc79 UTSW 12 103,058,286 (GRCm39) missense probably benign 0.00
R0211:Unc79 UTSW 12 103,039,051 (GRCm39) missense probably benign 0.01
R0211:Unc79 UTSW 12 103,039,051 (GRCm39) missense probably benign 0.01
R0218:Unc79 UTSW 12 103,075,040 (GRCm39) splice site probably null
R0244:Unc79 UTSW 12 103,079,150 (GRCm39) missense probably damaging 1.00
R0305:Unc79 UTSW 12 103,079,459 (GRCm39) missense probably benign 0.18
R0310:Unc79 UTSW 12 103,027,666 (GRCm39) missense probably damaging 1.00
R0325:Unc79 UTSW 12 103,137,903 (GRCm39) missense probably damaging 0.98
R0369:Unc79 UTSW 12 103,055,031 (GRCm39) critical splice donor site probably null
R0450:Unc79 UTSW 12 103,045,329 (GRCm39) critical splice donor site probably null
R0503:Unc79 UTSW 12 103,045,127 (GRCm39) missense probably benign 0.01
R0542:Unc79 UTSW 12 103,060,437 (GRCm39) splice site probably benign
R0845:Unc79 UTSW 12 103,139,703 (GRCm39) splice site probably benign
R0893:Unc79 UTSW 12 102,957,687 (GRCm39) missense probably damaging 1.00
R1078:Unc79 UTSW 12 103,041,112 (GRCm39) missense probably benign 0.03
R1148:Unc79 UTSW 12 103,078,926 (GRCm39) missense probably damaging 1.00
R1148:Unc79 UTSW 12 103,078,926 (GRCm39) missense probably damaging 1.00
R1159:Unc79 UTSW 12 103,013,311 (GRCm39) splice site probably benign
R1191:Unc79 UTSW 12 103,013,271 (GRCm39) nonsense probably null
R1307:Unc79 UTSW 12 103,036,335 (GRCm39) missense probably damaging 1.00
R1368:Unc79 UTSW 12 103,122,772 (GRCm39) missense probably damaging 1.00
R1476:Unc79 UTSW 12 103,149,784 (GRCm39) missense probably damaging 1.00
R1650:Unc79 UTSW 12 103,079,052 (GRCm39) missense possibly damaging 0.85
R1777:Unc79 UTSW 12 103,078,714 (GRCm39) missense probably damaging 1.00
R1796:Unc79 UTSW 12 103,109,005 (GRCm39) missense probably damaging 0.99
R1824:Unc79 UTSW 12 103,025,579 (GRCm39) missense probably damaging 1.00
R1830:Unc79 UTSW 12 103,100,737 (GRCm39) missense probably damaging 1.00
R1927:Unc79 UTSW 12 103,135,951 (GRCm39) missense probably damaging 1.00
R1958:Unc79 UTSW 12 103,041,178 (GRCm39) missense probably benign 0.19
R1958:Unc79 UTSW 12 102,957,621 (GRCm39) missense probably damaging 1.00
R1980:Unc79 UTSW 12 102,977,538 (GRCm39) nonsense probably null
R2019:Unc79 UTSW 12 103,137,830 (GRCm39) critical splice acceptor site probably null
R2290:Unc79 UTSW 12 103,112,625 (GRCm39) missense probably damaging 1.00
R2939:Unc79 UTSW 12 102,957,684 (GRCm39) missense probably damaging 1.00
R2962:Unc79 UTSW 12 103,061,378 (GRCm39) missense possibly damaging 0.72
R3176:Unc79 UTSW 12 103,079,476 (GRCm39) missense probably damaging 1.00
R3276:Unc79 UTSW 12 103,079,476 (GRCm39) missense probably damaging 1.00
R3683:Unc79 UTSW 12 103,041,062 (GRCm39) missense probably benign 0.00
R3684:Unc79 UTSW 12 103,041,062 (GRCm39) missense probably benign 0.00
R3686:Unc79 UTSW 12 103,054,920 (GRCm39) missense probably damaging 1.00
R3760:Unc79 UTSW 12 103,058,964 (GRCm39) missense probably damaging 1.00
R4031:Unc79 UTSW 12 103,039,018 (GRCm39) missense possibly damaging 0.46
R4039:Unc79 UTSW 12 103,041,208 (GRCm39) missense possibly damaging 0.88
R4110:Unc79 UTSW 12 103,025,629 (GRCm39) missense probably damaging 1.00
R4113:Unc79 UTSW 12 103,025,629 (GRCm39) missense probably damaging 1.00
R4159:Unc79 UTSW 12 103,036,512 (GRCm39) intron probably benign
R4273:Unc79 UTSW 12 103,088,612 (GRCm39) missense probably damaging 0.99
R4292:Unc79 UTSW 12 103,149,703 (GRCm39) missense probably damaging 0.99
R4334:Unc79 UTSW 12 103,045,233 (GRCm39) missense probably benign
R4513:Unc79 UTSW 12 102,988,019 (GRCm39) missense probably damaging 1.00
R4562:Unc79 UTSW 12 102,957,720 (GRCm39) missense probably damaging 1.00
R4576:Unc79 UTSW 12 102,968,062 (GRCm39) splice site probably benign
R4645:Unc79 UTSW 12 103,079,081 (GRCm39) missense probably benign
R4758:Unc79 UTSW 12 103,128,080 (GRCm39) nonsense probably null
R4787:Unc79 UTSW 12 103,013,257 (GRCm39) missense probably damaging 1.00
R4852:Unc79 UTSW 12 103,139,725 (GRCm39) missense probably damaging 0.98
R4883:Unc79 UTSW 12 103,060,592 (GRCm39) missense probably damaging 0.99
R4898:Unc79 UTSW 12 103,128,079 (GRCm39) missense probably damaging 0.99
R4979:Unc79 UTSW 12 103,078,691 (GRCm39) missense probably benign
R5044:Unc79 UTSW 12 103,078,962 (GRCm39) missense probably benign 0.32
R5053:Unc79 UTSW 12 103,071,007 (GRCm39) missense probably damaging 1.00
R5061:Unc79 UTSW 12 103,134,700 (GRCm39) missense possibly damaging 0.94
R5075:Unc79 UTSW 12 103,041,213 (GRCm39) missense possibly damaging 0.63
R5101:Unc79 UTSW 12 103,078,769 (GRCm39) missense probably damaging 1.00
R5236:Unc79 UTSW 12 103,060,654 (GRCm39) critical splice donor site probably null
R5240:Unc79 UTSW 12 103,037,010 (GRCm39) missense probably damaging 0.99
R5383:Unc79 UTSW 12 103,070,886 (GRCm39) missense possibly damaging 0.53
R5461:Unc79 UTSW 12 103,078,397 (GRCm39) missense probably damaging 1.00
R5535:Unc79 UTSW 12 103,135,962 (GRCm39) missense possibly damaging 0.84
R5609:Unc79 UTSW 12 103,094,527 (GRCm39) missense probably benign
R5639:Unc79 UTSW 12 103,137,831 (GRCm39) missense probably damaging 1.00
R5704:Unc79 UTSW 12 102,968,202 (GRCm39) missense probably damaging 1.00
R5923:Unc79 UTSW 12 103,078,727 (GRCm39) missense probably damaging 1.00
R5925:Unc79 UTSW 12 103,091,989 (GRCm39) splice site probably null
R5975:Unc79 UTSW 12 103,091,885 (GRCm39) missense possibly damaging 0.53
R6047:Unc79 UTSW 12 103,027,717 (GRCm39) missense probably damaging 1.00
R6156:Unc79 UTSW 12 103,027,717 (GRCm39) missense probably damaging 1.00
R6175:Unc79 UTSW 12 103,149,708 (GRCm39) missense probably damaging 0.98
R6292:Unc79 UTSW 12 103,108,991 (GRCm39) missense possibly damaging 0.88
R6313:Unc79 UTSW 12 103,078,878 (GRCm39) missense probably damaging 1.00
R6391:Unc79 UTSW 12 102,987,269 (GRCm39) missense probably damaging 1.00
R6405:Unc79 UTSW 12 103,134,595 (GRCm39) missense probably damaging 0.97
R6416:Unc79 UTSW 12 103,097,905 (GRCm39) missense possibly damaging 0.86
R6467:Unc79 UTSW 12 103,139,771 (GRCm39) missense probably damaging 1.00
R6573:Unc79 UTSW 12 103,027,647 (GRCm39) missense probably damaging 1.00
R6614:Unc79 UTSW 12 102,957,689 (GRCm39) missense probably damaging 1.00
R6654:Unc79 UTSW 12 103,045,308 (GRCm39) missense probably damaging 1.00
R6654:Unc79 UTSW 12 103,045,307 (GRCm39) missense probably damaging 0.99
R6700:Unc79 UTSW 12 103,091,962 (GRCm39) missense possibly damaging 0.92
R6724:Unc79 UTSW 12 103,071,120 (GRCm39) missense probably damaging 1.00
R6819:Unc79 UTSW 12 103,108,267 (GRCm39) missense probably benign 0.12
R6869:Unc79 UTSW 12 103,079,331 (GRCm39) missense probably benign 0.33
R6879:Unc79 UTSW 12 103,115,046 (GRCm39) splice site probably null
R6942:Unc79 UTSW 12 103,088,704 (GRCm39) critical splice donor site probably null
R6961:Unc79 UTSW 12 103,079,174 (GRCm39) missense probably damaging 1.00
R6973:Unc79 UTSW 12 102,964,699 (GRCm39) missense possibly damaging 0.86
R6980:Unc79 UTSW 12 103,025,759 (GRCm39) missense probably damaging 1.00
R7124:Unc79 UTSW 12 103,027,652 (GRCm39) missense probably damaging 0.99
R7144:Unc79 UTSW 12 103,108,885 (GRCm39) missense probably benign 0.06
R7197:Unc79 UTSW 12 103,078,765 (GRCm39) missense probably benign
R7209:Unc79 UTSW 12 103,091,883 (GRCm39) missense probably benign
R7232:Unc79 UTSW 12 103,100,734 (GRCm39) missense possibly damaging 0.49
R7304:Unc79 UTSW 12 103,029,449 (GRCm39) missense probably damaging 1.00
R7354:Unc79 UTSW 12 103,108,961 (GRCm39) missense possibly damaging 0.79
R7384:Unc79 UTSW 12 103,137,837 (GRCm39) missense probably benign 0.11
R7400:Unc79 UTSW 12 103,070,889 (GRCm39) missense probably damaging 1.00
R7417:Unc79 UTSW 12 103,055,017 (GRCm39) missense possibly damaging 0.85
R7470:Unc79 UTSW 12 103,061,235 (GRCm39) missense probably damaging 1.00
R7842:Unc79 UTSW 12 103,058,313 (GRCm39) missense probably damaging 1.00
R8037:Unc79 UTSW 12 103,016,178 (GRCm39) missense probably damaging 1.00
R8041:Unc79 UTSW 12 103,054,726 (GRCm39) missense probably benign 0.06
R8146:Unc79 UTSW 12 103,036,416 (GRCm39) missense probably damaging 0.98
R8276:Unc79 UTSW 12 102,968,122 (GRCm39) missense possibly damaging 0.94
R8427:Unc79 UTSW 12 103,045,297 (GRCm39) missense probably benign 0.24
R8501:Unc79 UTSW 12 103,058,897 (GRCm39) missense probably damaging 1.00
R8510:Unc79 UTSW 12 103,070,898 (GRCm39) missense probably damaging 1.00
R8531:Unc79 UTSW 12 103,049,855 (GRCm39) missense probably benign 0.13
R8531:Unc79 UTSW 12 103,013,922 (GRCm39) missense probably damaging 1.00
R8795:Unc79 UTSW 12 103,074,513 (GRCm39) missense probably damaging 1.00
R9017:Unc79 UTSW 12 103,074,874 (GRCm39) critical splice acceptor site probably null
R9121:Unc79 UTSW 12 102,968,095 (GRCm39) missense probably damaging 1.00
R9196:Unc79 UTSW 12 103,078,613 (GRCm39) missense probably benign
R9443:Unc79 UTSW 12 103,037,035 (GRCm39) missense probably damaging 1.00
R9548:Unc79 UTSW 12 102,977,495 (GRCm39) missense probably damaging 1.00
R9600:Unc79 UTSW 12 103,135,972 (GRCm39) missense probably benign 0.07
R9767:Unc79 UTSW 12 103,079,234 (GRCm39) missense probably benign
R9787:Unc79 UTSW 12 103,112,620 (GRCm39) missense probably benign 0.00
X0017:Unc79 UTSW 12 103,074,520 (GRCm39) missense probably damaging 0.99
X0028:Unc79 UTSW 12 102,957,662 (GRCm39) missense probably damaging 1.00
Z1088:Unc79 UTSW 12 102,987,271 (GRCm39) missense probably damaging 1.00
Z1176:Unc79 UTSW 12 103,108,312 (GRCm39) missense probably benign 0.03
Z1176:Unc79 UTSW 12 103,054,937 (GRCm39) missense probably damaging 1.00
Z1177:Unc79 UTSW 12 103,131,948 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTTGGGTAACAATGCTG -3'
(R):5'- TTCGGGAACTTTGAGGAGCAC -3'

Sequencing Primer
(F):5'- TGGGTAACAATGCTGCCTCC -3'
(R):5'- GAGCACAGTTTTGACCCCTGATG -3'
Posted On 2019-12-04